Engineering Immune Evasion: How HLA-E Knockin at the B2M Locus Confers NK Cell Protection in Allogeneic Cell Therapies

Levi James Jan 12, 2026 245

This article provides a comprehensive guide for researchers and drug developers on the innovative strategy of knocking HLA-E into the β2-microglobulin (B2M) locus to protect therapeutic cells from natural killer...

Engineering Immune Evasion: How HLA-E Knockin at the B2M Locus Confers NK Cell Protection in Allogeneic Cell Therapies

Abstract

This article provides a comprehensive guide for researchers and drug developers on the innovative strategy of knocking HLA-E into the β2-microglobulin (B2M) locus to protect therapeutic cells from natural killer (NK) cell-mediated rejection. We explore the foundational immunology of HLA-E and NKG2A interactions, detail state-of-the-art genome engineering methodologies (including CRISPR/Cas9 strategies), analyze common challenges in achieving stable HLA-E expression and functional B2M knockout, and compare the efficacy of this approach against other immune-evasive edits. The content synthesizes recent preclinical data to validate this platform's potential for creating universally compatible 'off-the-shelf' cell therapies, such as CAR-T and stem cell-derived products.

The Science of Stealth: Understanding HLA-E, B2M, and NK Cell Immune Evasion

The development of allogeneic “off-the-shelf” cell therapies, particularly those derived from induced pluripotent stem cells (iPSCs), is a major frontier in regenerative medicine and oncology. A common strategy to avoid T cell-mediated graft rejection involves knockout (KO) of Beta-2-Microglobulin (B2M), a critical component of the Major Histocompatibility Complex (MHC) Class I molecule. While this effectively evades cytotoxic T lymphocytes, it paradoxically renders these therapeutic cells vulnerable to elimination by natural killer (NK) cells, a phenomenon known as the "missing self" response.

This application note details the mechanistic basis for this rejection and frames it within the context of a leading-edge solution: the knockin (KI) of non-classical MHC class I molecule HLA-E into the B2M locus. This strategy aims to restore a single, universal inhibitory ligand for NK cells while maintaining the absence of polymorphic HLA-A, -B, -C molecules that drive T cell alloreactivity.

Mechanistic Basis of NK-Mediated Rejection

NK cell activity is governed by a balance of signals from activating and inhibitory receptors. The inhibitory receptor NKG2A/CD94 heterodimer specifically recognizes HLA-E. HLA-E stabilizes at the cell surface only when bound to a limited set of leader peptide sequences derived from classical MHC class I molecules (HLA-A, -B, -C, -G) or engineered peptides, a process strictly dependent on B2M.

Table 1: Key Receptor-Ligand Interactions Governing NK Cell Recognition of B2M-KO Cells

Receptor on NK Cell Ligand on Target Cell Signal Type Status in B2M-KO Cells Consequence
NKG2A/CD94 HLA-E complexed with peptide & B2M Inhibitory Absent (HLA-E not surface expressed) Loss of primary inhibitory signal.
KIR2DL1/2/3, LILRB1 HLA-C, -B, -A alleles Inhibitory Absent (All classical MHC-I lost) Loss of multiple inhibitory signals.
NKG2D Stress ligands (e.g., MICA, MICB) Activating Often Upregulated on cultured/therapeutic cells Potent activating signal.
DNAM-1 PVR (CD155), Nectin-2 Activating Typically Present Activating signal.
Natural Cytotoxicity Receptors (e.g., NKp46) Viral/tumor ligands Activating Variable Potential activating signal.

In B2M-KO cells, the loss of surface HLA-E and all classical MHC I molecules results in a complete absence of inhibitory signals for NKG2A and Killer Immunoglobulin-like Receptors (KIRs). This unopposed activation, driven by ligands for NKG2D, DNAM-1, and other receptors, triggers NK cell cytotoxicity, cytokine release, and rejection of the therapeutic cells.

The proposed solution is to knock a HLA-E gene, fused to a defined peptide leader sequence (e.g., from HLA-G or B2M signal peptide), into the B2M locus. This achieves:

  • B2M Disruption: Continued avoidance of polymorphic HLA-A/B/C presentation.
  • HLA-E Expression: Single-allele, B2M-independent HLA-E surface expression providing a universal inhibitory signal for NKG2A+ NK cells.
  • Locus Control: Endogenous B2M promoter drives consistent, physiological expression.

Table 2: Quantitative Comparison of Cell Phenotypes

Cell Type Surface HLA-A/B/C Surface HLA-E NKG2A/CD94 Inhibition KIR Inhibition Susceptibility to NK Cells (in vitro % lysis)*
Wild-Type High High Yes Yes (if cognate HLA present) Low (10-20%)
B2M-KO None None/very low No No High (60-80%)
HLA-E KI in B2M locus None High Yes No Low-Medium (20-35%)*

*Representative data from cytotoxicity assays using NKG2A+ NK cell lines. Lysis of HLA-E KI cells remains higher than WT due to lack of KIR inhibition.

Detailed Experimental Protocols

Protocol 1: In Vitro NK Cell Cytotoxicity Assay (Standard (^{51})Cr Release)

Purpose: Quantify lysis of engineered (B2M-KO, HLA-E KI) vs. control cells by primary human NK cells. Key Reagents: See Scientist's Toolkit below. Procedure:

  • Target Cell Labeling: Harvest 1x10(^6) target cells (WT, B2M-KO, HLA-E KI). Resuspend in 100 µL medium and add 100 µCi Na(2)(^{51})CrO(4). Incubate 90 min at 37°C.
  • Washing: Wash cells 3x with complete medium to remove unincorporated (^{51})Cr. Count and resuspend at 1x10(^5) cells/mL.
  • Effector Cell Prep: Isolate primary human NK cells from PBMCs (negative selection kit). Activate with 100 U/mL IL-2 for 16-24h.
  • Co-culture: In a 96-well U-bottom plate, plate 100 µL of target cells (10(^4) cells/well). Add 100 µL of effector cells at varying Effector:Target (E:T) ratios (e.g., 50:1, 25:1, 12.5:1, 6.25:1). Include controls: target cells alone (spontaneous release) and with 1% Triton X-100 (maximum release). Triplicate wells per condition.
  • Incubation: Centrifuge plate (500 rpm, 3 min) for contact. Incubate 4-6h at 37°C.
  • Measurement: Centrifuge plate (1200 rpm, 5 min). Transfer 100 µL supernatant from each well to a LumaPlate. Measure radioactivity (CPM) on a MicroBeta2 scintillation counter.
  • Calculation: % Specific Lysis = [(Experimental CPM – Spontaneous CPM) / (Maximum CPM – Spontaneous CPM)] x 100.

Protocol 2: Validation of HLA-E Surface Expression by Flow Cytometry

Purpose: Confirm successful HLA-E surface expression on KI cells independent of classical MHC-I. Procedure:

  • Staining: Harvest 2-5x10(^5) cells per sample. Wash with FACS buffer (PBS + 2% FBS).
  • Block: Incubate cells with Human TruStain FcX for 10 min on ice.
  • Label: Add antibody cocktails (30 min, 4°C, dark):
    • Sample 1: Anti-HLA-A,B,C-APC + Anti-HLA-E-PE.
    • Sample 2: Relevant Isotype controls.
    • Sample 3: (Optional) Anti-B2M-FITC.
  • Wash & Analyze: Wash 2x, resuspend in buffer. Acquire on flow cytometer. Analyze for HLA-E PE+ / HLA-A,B,C APC- population.

Protocol 3: NKG2A-Blocking Assay to Validate Mechanism

Purpose: Demonstrate that NK cell protection is specifically mediated via the NKG2A/HLA-E axis. Procedure:

  • Perform Protocol 1, but pre-incubate effector NK cells (for 30 min at 37°C) with either: a) Anti-human NKG2A blocking antibody (e.g., Clone: 131411, 10 µg/mL). b) Isotype control antibody.
  • Add pre-treated effectors to labeled HLA-E KI target cells without washing.
  • Complete the cytotoxicity assay. An increase in lysis in the NKG2A-blocked condition confirms the specific protective role of this pathway.

Signaling Pathway & Experimental Workflow Diagrams

G cluster_B2MKO B2M-KO Therapeutic Cell cluster_HLAE_KI HLA-E KI Therapeutic Cell title NK Cell Activation Balance: B2M-KO vs. HLA-E KI B2MKO No HLA-E No MHC-I Inh_B2MKO Inhibitory Signals NONE B2MKO->Inh_B2MKO HLAE Stable HLA-E No MHC-I Inh_HLAE Inhibitory Signal NKG2A/CD94 → HLA-E HLAE->Inh_HLAE NK NK Cell Outcome1 Outcome: STRONG ACTIVATION & Cytolysis NK->Outcome1 Outcome2 Outcome: BALANCED SIGNAL (Partial Protection) NK->Outcome2 Act Activating Signals (NKG2D, DNAM-1, NCRs) Act->NK Inh_B2MKO->NK  Missing Inh_HLAE->NK

Diagram 1 Title: NK Cell Activation Balance: B2M-KO vs. HLA-E KI

G title HLA-E KI in B2M Locus: Experimental Workflow Step1 1. Design KI Construct: HLA-E + peptide sequence, Homology arms for B2M locus Step2 2. Deliver to iPSCs: e.g., CRISPR/Cas9 RNP + donor template Step1->Step2 Step3 3. Select & Clone: Puromycin selection, single-cell cloning Step2->Step3 Step4 4. Molecular Validation: PCR genotyping, Sanger sequencing Step3->Step4 Step5 5. Phenotypic Validation: Flow cytometry for HLA-E+ / HLA-A,B,C- Step4->Step5 Step6 6. Functional Assay: NK cytotoxicity assay (Protocol 1) Step5->Step6 Step7 7. Mechanistic Assay: NKG2A-blocking assay (Protocol 3) Step6->Step7

Diagram 2 Title: HLA-E KI in B2M Locus: Experimental Workflow

The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Reagents for HLA-E Knockin & Validation Studies

Item Example Product/Catalog # Function in Research
Anti-human HLA-E Antibody BioLegend, clone 3D12 (PE conjugate) Gold-standard for detecting surface HLA-E by flow cytometry.
Anti-human HLA-A,B,C Antibody BioLegend, clone W6/32 (APC conjugate) Pan-MHC Class I antibody to confirm loss of polymorphic HLA.
Recombinant Human IL-2 PeproTech, #200-02 For activation and expansion of primary human NK cells.
Human NK Cell Isolation Kit Miltenyi Biotec, #130-092-657 Negative selection for high-purity primary NK cells from PBMCs.
Anti-human NKG2A Blocking Antibody R&D Systems, MAB1059 (clone 131411) Critical for mechanistic studies to inhibit NKG2A/HLA-E interaction.
CRISPR-Cas9 System (RNP) Synthego or IDT For precise knockout of B2M and knockin of HLA-E donor.
HLA-E KI Donor Template Custom-designed gBlocks/Gene Fragment (IDT) Homology-directed repair template with HLA-E sequence and selection marker.
Sodium Chromate-51 PerkinElmer, NEZ030 Radioactive label for quantitative, gold-standard cytotoxicity assays.
LumaPlate-96 PerkinElmer, #6006629 Solid scintillation plates for measuring 51Cr release.

This application note details protocols central to a thesis investigating HLA-E-mediated NK cell protection in HLA-E knockin B2M locus models. The core hypothesis posits that targeted disruption of the HLA-E/NKG2A/CD94 axis can recalibrate NK cell function, offering a novel strategy for enhancing immune surveillance in cancer and infection. Experiments are designed to validate knockin models, quantify checkpoint interactions, and test therapeutic blockade.

Table 1: Binding Affinity and Cellular Expression Data for HLA-E/NKG2A/CD94 System

Parameter Value / Range Measurement Method Reference / Model
HLA-E / NKG2A-CD94 Kd ~1-4 µM Surface Plasmon Resonance (SPR) Recombinant protein assay
HLA-E (cell surface) High (B2M-dep. cells) Flow Cytometry (MFI) HLA-E KI B2M locus cell line
NKG2A+ NK Cells (Human PBMC) 30-50% Flow Cytometry Healthy donor lymphocytes
Inhibition of NK Cytolysis 40-70% reduction Calcein-AM release assay Target cells expressing HLA-E
mAb Blockade Efficacy (IC50) 0.1-1 µg/mL IFN-γ ELISpot / Cytotoxicity Anti-NKG2A (e.g., Monalizumab)

Table 2: Phenotypic Changes in NK Cells Upon NKG2A Blockade (In Vitro)

NK Cell Parameter Change (vs. Isotype Control) Assay Duration Context
IFN-γ production ↑ 2.5 to 4-fold 24h co-culture HLA-E+ target cells
CD107a degranulation ↑ 35-60% 4h cytotoxicity assay HLA-E+ tumor line
Proliferation (CFSE dilution) ↑ 1.8-fold 5-day culture IL-15 + HLA-E+ feeders
Phospho-SHP-1/2 ↓ 70-80% 15-min stimulation Crosslinking NKG2A

Detailed Experimental Protocols

Protocol 3.1: Validation of HLA-E Knockin at B2M Locus

Objective: Confirm genomic integration and surface expression of HLA-E in engineered cell lines. Materials: HLA-E knockin cell line, isogenic control, PCR reagents, flow cytometry antibodies. Steps:

  • Genomic DNA PCR: Isolate gDNA. Use primers flanking the B2M homology arms and HLA-E insert.
    • PCR Program: 98°C 30s; [98°C 10s, 65°C 30s, 72°C 2min] x 35 cycles; 72°C 5min.
  • Surface Expression (Flow Cytometry): Harvest 1e6 cells. Stain with anti-HLA-E (3D12 clone) APC and anti-B2M FITC. Include isotype controls.
  • Acquisition: Analyze on flow cytometer. Confirm co-expression of HLA-E and B2M.

Protocol 3.2: NK Cell Cytotoxicity Assay with Checkpoint Blockade

Objective: Measure NK cell killing of HLA-E+ targets with/without NKG2A blockade. Materials: Primary human NK cells (isolated via negative selection), HLA-E knockin target cells, calcein-AM, anti-NKG2A blocking antibody (e.g., clone Z199), effector:target (E:T) plates. Steps:

  • Label Targets: Label 1e6 HLA-E+ target cells with 5 µM calcein-AM for 30 min at 37°C. Wash.
  • Pre-treat Effectors: Incubate NK cells with 10 µg/mL anti-NKG2A or isotype for 30 min.
  • Co-culture: Plate targets (1e4/well) with effectors at E:T ratios (e.g., 50:1, 25:1, 12.5:1) in triplicate. Include target-only (spontaneous) and lysis (max) controls.
  • Incubate: 2 hours at 37°C, 5% CO2.
  • Measure: Transfer supernatant to black plate. Read fluorescence (ex/em ~485/535nm).
  • Calculate: % Specific Lysis = (Test – Spontaneous) / (Max – Spontaneous) x 100.

Protocol 3.3: Phospho-Signaling Analysis via Western Blot

Objective: Detect inhibition of SHP-1/2 phosphorylation upon NKG2A engagement. Materials: NK cell line (e.g., NKL), recombinant HLA-E tetramer, crosslinking antibody, lysis buffer, anti-pSHP-1 (Y564)/pSHP-2 (Y542), total SHP-1/2 antibodies. Steps:

  • Stimulation: Aliquot 5e6 NKL cells/treatment.
    • Condition 1: HLA-E tetramer (2 µg/mL) for 15 min at 37°C.
    • Condition 2: HLA-E tetramer + crosslinking Ab (5 µg/mL).
    • Control: PBS.
  • Lysis: Immediately lyse cells in RIPA buffer + phosphatase/protease inhibitors.
  • Immunoblot: Run 30 µg protein on 10% SDS-PAGE. Transfer to PVDF.
  • Detection: Block, incubate with primary antibodies (1:1000) overnight at 4°C. Use HRP-secondaries and ECL. Quantify band intensity.

Signaling Pathway & Workflow Diagrams

G HLA_E HLA-E (Peptide-B2M complex) ReceptorComplex NKG2A/CD94 Receptor Complex HLA_E->ReceptorComplex Engagement NKG2A NKG2A NKG2A->ReceptorComplex CD94 CD94 CD94->ReceptorComplex ITIMs ITIM Motifs (Y7, Y8) SHP1 SHP-1 ITIMs->SHP1 Recruits SHP2 SHP-2 ITIMs->SHP2 Recruits Vav1 Vav1 SHP1->Vav1 Dephosphorylates (Inactivates) SHP2->Vav1 Dephosphorylates (Inactivates) Actin Actin Remodeling Vav1->Actin No Signal Inhibition Inhibition of NK Cell Activation Actin->Inhibition ReceptorComplex->ITIMs Phosphorylation

Title: HLA-E/NKG2A Inhibitory Signaling Pathway

G Start Start: HLA-E KI B2M Locus Model Val1 Genomic Validation (PCR, Sequencing) Start->Val1 Val2 Surface Expression (Flow Cytometry) Start->Val2 Func1 Functional Assay: Cytotoxicity with Blockade Val1->Func1 Val2->Func1 Func2 Cytokine Release (IFN-γ ELISpot/ELISA) Func1->Func2 Mech2 ITIM Mutation (CRISPR Control) Func1->Mech2 Mech1 Mechanistic Study: Phospho-Western Blot Func2->Mech1 End Thesis Integration: NK Protection Calibration Mech1->End Mech2->End

Title: Experimental Workflow for Thesis Research

The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Reagents for HLA-E/NKG2A Research

Reagent / Material Function / Application Example (Clone/Catalog)
Anti-Human HLA-E mAb Detection of surface HLA-E expression in KI models. 3D12 (MEM-E/06), PE or APC conjugate.
Anti-Human NKG2A mAb (Blocking) Functional blockade of the inhibitory checkpoint in assays. Z199 (IgG2a), Monalizumab (clinical grade).
Recombinant HLA-E Tetramer Specific engagement of NKG2A/CD94 for signaling studies. Tetramer loaded with VMAPRTLVL (B2M signal peptide).
Phospho-SHP-1 (Y564) Ab Readout of proximal inhibitory signaling via Western Blot. Rabbit monoclonal, multiple suppliers.
HLA-E Knockin Cell Line Engineered target cell for functional co-culture assays. K562 or HEK293 with HLA-E KI at B2M locus.
Negative Selection NK Kit Isolation of primary human NK cells from PBMCs. Miltenyi Biotec NK Cell Isolation Kit.
Calcein-AM Fluorescent dye for real-time cytotoxicity measurement. Thermo Fisher, C3099.
CRISPR Guide RNA (ITIM) Generate NKG2A-ITIM mutant controls in NK cell lines. sgRNA targeting NKG2A tyrosine residues.

1. Introduction and Scientific Rationale Within the broader thesis on generating universal cellular therapeutics with enhanced resistance to host NK cell-mediated killing, targeting the Beta-2-Microglobulin (B2M) locus presents a unique one-step strategy. B2M is an essential, non-polymorphic component of all classical HLA class I (HLA-I) molecules (HLA-A, -B, -C). Its disruption abolishes surface expression of all classical HLA-I, mitigating CD8+ T-cell allorejection. However, this renders cells vulnerable to elimination by NK cells via "missing self" recognition. To circumvent this, the B2M locus can be repurposed as a safe harbor for knock-in (KI) of the non-classical, inhibitory ligand HLA-E. HLA-E, when complexed with a limited set of peptides (e.g., from HLA-G or HLA-I signal sequences), engages the inhibitory receptor NKG2A/CD94 on NK cells and a subset of T cells, providing a broad "self" shield. This single genetic intervention achieves dual goals: elimination of polymorphic HLA-I and constitutive expression of a monomorphic NK-inhibitory ligand.

2. Quantitative Data Summary

Table 1: Comparative Outcomes of B2M Locus Editing Strategies in Human T Cells or iPSCs

Editing Strategy HLA-I Surface Expression (% of WT) HLA-E Surface Expression NK Cell Cytotoxicity (% Lysis) CD8+ T-Cell Alloreactivity
Unedited (WT) 100% Low/Negative 15-25% (Baseline) High
B2M Knockout (KO) <5% Negative 60-80% Abrogated
B2M-HLA-E KI (This Strategy) <5% High (Stable) 20-30% Abrogated
B2M KO + HLA-E Random Transgene <5% Variable/Moderate 30-50% Abrogated

Table 2: Key Reagents for B2M-HLA-E Knock-in via CRISPR/HDR

Reagent Category Specific Example/Sequence Function/Purpose
gRNA Target Site Human B2M exon 2 (near stop codon) Directs Cas9 to create a double-strand break (DSB) in the 3' end of the B2M coding sequence, enabling HDR.
Cas9 Nuclease SpCas9, HiFi Cas9 Creates a precise DSB at the genomic target. HiFi Cas9 reduces off-target effects.
HDR Donor Template dsDNA or AAV6 vector containing: 1. Homology arms (~800 bp flanking the cut site), 2. HLA-E*01:03 coding sequence, 3. P2A or T2A self-cleaving peptide, 4. Optional: reporter (e.g., GFP) or selectable marker (e.g., puromycin R). Provides the template for precise insertion of HLA-E into the B2M locus, maintaining endogenous regulatory elements for robust expression.
Delivery Method Electroporation (for RNP + dsDNA) or AAV6 transduction (for donor) Efficient intracellular delivery of editing components. AAV6 offers high HDR efficiency in many primary cell types.
NK Cell Assay Effectors Primary human NK cells (from peripheral blood) or NK-92 cell line. Used in functional cytotoxicity assays (e.g., calcein release, Incucyte) to validate NK protection conferred by HLA-E.
Flow Cytometry Antibodies Anti-HLA-ABC (W6/32), Anti-HLA-E (3D12), Anti-B2M, Anti-NKG2A (for blocking). Critical for phenotyping edited cells: confirming loss of HLA-I and gain of HLA-E.

3. Detailed Experimental Protocols

Protocol 3.1: CRISPR/Cas9-Mediated B2M-HLA-E Knock-in in Primary Human T Cells Materials: Nucleofector, Primary human T cells, Cas9 protein, B2M-targeting gRNA, HDR donor DNA (dsDNA with ~800bp homology arms), IL-2 cytokine. Procedure:

  • Prepare RNP Complex: Complex 30pmol of Cas9 protein with 60pmol of B2M-targeting gRNA (pre-annealed) for 10 min at room temperature.
  • Electroporation: Mix 1-2e6 activated T cells with RNP complex and 1-2µg of HDR donor DNA in 100µL nucleofection solution. Electroporate using a pre-optimized program (e.g., Lonza P3 Primary Cell 96-well Nucleofector Kit, program EO-115).
  • Recovery and Culture: Immediately transfer cells to pre-warmed medium with 200U/mL IL-2. Culture at 37°C, 5% CO2.
  • Analysis: At day 5-7 post-editing, analyze editing efficiency via flow cytometry for HLA-ABC loss and HLA-E expression. Genomic validation by PCR and sequencing across homology arms is essential.

Protocol 3.2: Functional NK Cell Protection Assay Materials: Edited T cells (B2M KO vs. B2M-HLA-E KI), Calcein AM dye, Primary human NK cells (isolated from a different donor using CD56+ microbeads), Anti-NKG2A blocking antibody (clone: Z199). Procedure:

  • Label Target Cells: Label 1e6 edited T cells (targets) with 5µM Calcein AM for 30 min at 37°C. Wash twice.
  • Coatplate Effectors: Seed primary NK cells (effectors) in a 96-well U-bottom plate at varying Effector:Target (E:T) ratios (e.g., 5:1, 10:1, 20:1). For blocking conditions, pre-incubate NK cells with 10µg/mL anti-NKG2A for 30 min.
  • Co-culture: Add 1e4 calcein-labeled target cells to each well. Include targets alone (spontaneous release) and with 1% Triton X-100 (maximum release). Centrifuge briefly and incubate for 4 hours at 37°C.
  • Measurement: Transfer supernatant to a black-walled plate. Measure fluorescence (ex 485nm/em 535nm). Calculate % specific lysis: [(Experimental Release – Spontaneous Release) / (Maximum Release – Spontaneous Release)] * 100.
  • Interpretation: B2M-HLA-E KI cells should show significantly reduced lysis compared to B2M KO cells, which is reversible with NKG2A blockade, confirming HLA-E/NKG2A-mediated protection.

4. Visualizations

b2m_editing_strategy WT Wild-Type Cell (HLA-ABC+, HLA-E low) KO B2M Knockout (KO) (HLA-ABC-, HLA-E-) WT->KO CRISPR/Cas9 B2M Disruption KI B2M-HLA-E Knock-in (KI) (HLA-ABC-, HLA-E+) WT->KI CRISPR/HDR B2M-HLA-E KI Tcell CD8+ T-Cell Response KO->Tcell Allorecognition Abrogated NKcell NK Cell Response KO->NKcell 'Missing Self' Strong Activation KI->Tcell Allorecognition Abrogated KI->NKcell HLA-E binds NKG2A/CD94 Inhibition

Diagram Title: B2M Editing Strategies and Immune Cell Outcomes

experimental_workflow Step1 1. Design & Synthesis Step2 2. Delivery Step1->Step2 Sub1 gRNA design to B2M exon 2 HDR donor template with HLA-E Step1->Sub1 Step3 3. Culture & Expansion Step2->Step3 Sub2 Electroporation of RNP + dsDNA donor or AAV6 donor transduction Step2->Sub2 Step4 4. Validation Step3->Step4 Sub3 Culture with IL-2 (T cells) or appropriate cytokines Step3->Sub3 Step5 5. Functional Assay Step4->Step5 Sub4 Flow Cytometry: HLA-ABC loss & HLA-E gain PCR & Sanger Sequencing Step4->Sub4 Sub5 Co-culture with allogeneic NK cells Calcein AM cytotoxicity assay Step5->Sub5

Diagram Title: B2M-HLA-E KI Experimental Workflow

hla_e_signaling HLAE HLA-E/Peptide Complex NKG2A NKG2A (Inhibitory) HLAE->NKG2A engages ITIM ITIM Motifs (in cytoplasm) NKG2A->ITIM phosphorylates CD94 CD94 CD94->NKG2A heterodimer SHP1 SHP-1/SHP-2 Phosphatases ITIM->SHP1 recruits Activation Blocked Activation Kinase Signaling SHP1->Activation dephosphorylates activation pathways

Diagram Title: HLA-E / NKG2A Inhibitory Signaling Pathway

5. The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Toolkit for B2M-HLA-E Research

Item Name Supplier Examples Function in Research
B2M KO Cell Line ATCC, CLS Positive control for HLA-I negative phenotype and high NK cell sensitivity.
Recombinant HLA-E Tetramer MBL, ProImmune Validate specific interaction with NKG2A/CD94 via flow cytometry or blocking experiments.
CRISPR Modification Detection Kit IDT (Surveyor, T7E1), Takara Bio Assess indel frequency and HDR efficiency at the B2M locus post-editing.
LIVE/DEAD Fixable Viability Dyes Thermo Fisher, BioLegend Distinguish live cells in cytotoxicity assays and flow cytometry, crucial for accurate analysis.
Incucyte Live-Cell Analysis System Sartorius Enables real-time, label-free monitoring of NK cell-mediated killing over time.
Genomic DNA Purification Kit (Magnetic Beads) Promega, Qiagen High-quality gDNA extraction for precise PCR and sequencing validation of knock-in junctions.

This document provides application notes and protocols for comparative studies of endogenous HLA-E and engineered HLA-E molecules, particularly within the context of HLA-E knockin at the B2M locus for NK cell protection research. Engineered HLA-E constructs aim to provide universal, stable cell protection from Natural Killer (NK) cell-mediated lysis, crucial for allogeneic cell therapies. The core functional distinction lies in peptide repertoire, stability, and loading mechanisms.

Key Comparative Points:

  • Peptide Source: Endogenous HLA-E primarily presents signal peptides from classical MHC class I molecules (e.g., HLA-A, -B, -C leader sequences). Engineered HLA-E often presents a single, optimized peptide (e.g., VMAPRTLVL from HLA-G) for high-stability, uniform expression.
  • Loading Pathway: Endogenous loading occurs via the standard MHC class I pathway (ER, tapasin dependence). Engineered systems may bypass elements of this pathway depending on design.
  • B2M Association: Both require β2-microglobulin (B2M). Knockin at the B2M locus ensures co-transcriptional regulation, promoting efficient assembly.
  • NK Cell Engagement: Both bind the inhibitory receptor CD94/NKG2A. Engineered systems are optimized for sustained, high-affinity engagement.

Data Presentation: Quantitative Comparisons

Table 1: Functional Properties of Endogenous vs. Engineered HLA-E

Property Endogenous HLA-E Engineered HLA-E (B2M Locus Knockin)
Primary Peptide Polymorphic; Canonical: VMAPRTLLL (HLA-G), VMAPRTLLL (HLA-A2), etc. Monomorphic; Optimized: e.g., VMAPRTLVL (HLA-G derived)
Peptide Diversity Limited (~10-20 leader sequences) Single or very limited (1-2 designed sequences)
Tapasin Dependence Partial/Context-dependent Often reduced or engineered to be independent
Surface Stability (t½) ~4-6 hours (peptide-dependent) >24 hours (optimized peptide)
CD94/NKG2A Affinity (KD) ~1-5 µM (peptide-dependent) ~0.5-2 µM (optimized)
NK Cell Inhibition Strong (with high-stability peptides) Consistently strong and uniform
Response to CMV gpUL40 Upregulated (mimics HLA-G peptide) Unaffected (if using non-UL40 peptide)

Table 2: Experimental Readouts for Comparative Assays

Assay Endogenous HLA-E Readout Engineered HLA-E Readout Key Implication
Flow Cytometry (Surface) Moderate, variable staining High, consistent staining Confirms expression & stability.
Thermostability (SDS-Dimer Assay) ~50-70% dimer (peptide-depleted) >90% dimer (optimally loaded) Measures peptide loading quality.
NK Cytotoxicity (Cr-51/LDH) 40-70% protection (peptide-dependent) >90% protection (consistent) Functional validation of NK shield.
Peptide Elution + MS Diverse leader peptide spectrum Dominant single peak Confirms peptide repertoire.

Experimental Protocols

Protocol 3.1: Assessment of HLA-E Surface Stability via Cycloheximide Chase

Objective: Quantify the half-life of surface HLA-E complexes to compare loading efficiency and complex stability.

  • Culture Cells: Maintain target cells (e.g., parental, HLA-E knockin) at 70% confluency.
  • Inhibit Protein Synthesis: Treat cells with 100 µg/mL cycloheximide. Prepare duplicate samples for each time point (0, 2, 4, 8, 12, 24h).
  • Harvest: At each time point, detach cells using non-enzymatic buffer, wash with PBS.
  • Stain: Stain cells with anti-HLA-E-APC (e.g., 3D12 clone) and a viability dye. Incubate for 30 min at 4°C, wash.
  • Acquire & Analyze: Analyze by flow cytometry. Calculate MFI for live, stained cells. Plot MFI (normalized to t=0) vs. time. Fit a one-phase decay curve to calculate half-life.

Protocol 3.2: In Vitro NK Cell Cytotoxicity Assay (LDH Release)

Objective: Functionally test NK cell protection conferred by endogenous vs. engineered HLA-E.

  • Effector Cells: Isolate NK cells from healthy donor PBMCs using negative selection. Rest overnight in IL-2 (100 U/mL).
  • Target Cells: Harvest engineered (HLA-E knockin) and control (B2M-/-) cells.
  • Coat Target Cells (Optional): For de novo loading tests, incubate targets with 10 µM of peptide (e.g., VL9 for endogenous, optimized peptide for engineered) in serum-free media for 2h at 37°C.
  • Co-Culture: Seed targets (10^4/well) in 96-well U-bottom plates. Add effectors at varying E:T ratios (e.g., 10:1, 5:1, 2.5:1). Include target spontaneous and maximum lysis controls.
  • Incubate: Centrifuge plates (200g, 2 min) and incubate for 4-6h at 37°C.
  • Measure LDH: Transfer 50µL supernatant to a fresh plate, add LDH detection reagent per manufacturer's instructions. Measure absorbance at 490nm (reference 650nm).
  • Calculate: % Cytotoxicity = [(Experimental - Target Spontaneous) / (Target Maximum - Target Spontaneous)] * 100.

Protocol 3.3: Evaluation of Peptide Loading Pathway Dependence

Objective: Determine tapasin/PLC dependence using transporter associated with antigen processing (TAP)-deficient cell lines.

  • Generate Model: Introduce HLA-E constructs (endogenous locus vs. engineered knockin) into TAP-deficient (e.g., .174/T2) and TAP-sufficient parental cells.
  • Surface Staining: Assess baseline HLA-E surface expression via flow cytometry (as in 3.1).
  • Thermostability Assay: Lyse 1x10^6 cells in 1% digitonin lysis buffer. Incubate lysate at 37°C for 15 min or leave on ice (control).
  • Immunoprecipitation: Add W6/32 antibody (binds HLA-E/B2M complexes) and protein G beads. Rotate overnight at 4°C.
  • Analyze: Wash beads, elute with non-reducing SDS sample buffer. Run on 10% Native PAGE. Western blot with anti-β2m. A stable complex (dimer) resists dissociation at 37°C.

Diagrams & Visualizations

G Start Initiate Comparative Study A Generate Cell Models: 1. Wild-Type 2. HLA-E Knockin @ B2M 3. B2M-/- Control Start->A B Assay 1: Phenotyping Flow Cytometry for HLA-E/B2M A->B C Assay 2: Stability Cycloheximide Chase & Thermostability B->C D Assay 3: Peptide Profile Elution & Mass Spectrometry C->D E Assay 4: Function NK Cytotoxicity (LDH Release) D->E F Data Integration & Comparison: - Expression Level - Complex Half-Life - Peptide Specificity - % NK Protection E->F End Conclusion: Validate Superior Stability & Function of Engineered Construct F->End

The Scientist's Toolkit: Key Research Reagent Solutions

Reagent/Material Function in HLA-E Research Example/Catalog Consideration
Anti-HLA-E mAb (3D12) Flow cytometry & immunoprecipitation of surface HLA-E/B2M complexes. BioLegend, clone 3D12; detects folded complex.
Anti-B2M mAb (W6/32) IP of mature HLA class I complexes; thermostability assays. Recognizes HLA heavy chain/B2M heterodimers.
Optimized HLA-E Peptides Peptide loading assays; stability enhancement. VL9 (VMAPRTLVL), HLA-A2 leader (VMAPRTLLL).
TAP-Deficient Cell Line (.174/T2) Determining peptide loading pathway dependence. CEM.T2 (ATCC CRL-1992).
Recombinant CD94/NKG2A Surface plasmon resonance (SPR) to measure binding affinity. R&D Systems or AcroBiosystems.
NK Cell Isolation Kit Rapid isolation of primary human NK cells for cytotoxicity assays. Miltenyi Biotec, Human NK Cell Isolation Kit.
Lactate Dehydrogenase (LDH) Assay Kit Quantifying NK cell-mediated cytotoxicity. Promega CytoTox 96 Non-Radioactive Assay.
CRISPR/Cas9 System (B2M gRNA) Generating B2M-/- controls or creating knockin at B2M locus. Synthego or IDT for synthetic gRNAs.
HLA-E Tetramers (Peptide-loaded) Identifying NKG2A+ NK cells or staining antigen-specific cells. NIH Tetramer Core or MBL International.

Building the Stealth Cell: Step-by-Step Guide to HLA-E Knockin at the B2M Locus

Application Notes

Within the context of HLA-E knockin B2M locus research for enhancing NK cell protection in cell therapies, the precision of CRISPR/Cas9-mediated gene editing is paramount. Successful knockin requires high-efficiency, on-target cleavage at the B2M locus with minimal off-target effects, followed by homology-directed repair (HDR) using a donor template. This document outlines the strategic selection of gRNAs and donor design for this critical application.

1. Key Considerations for gRNA Selection:

  • Target Region: gRNAs should be designed to cut within or immediately adjacent to the B2M start codon (exon 1) or early exons to facilitate complete gene disruption and create a precise insertion site for the HLA-E transgene.
  • On-Target Efficiency Prediction: Use established algorithms (e.g., Doench ‘16, Moreno-Mateos scores) to rank gRNAs.
  • Off-Target Profiling: Comprehensive in silico analysis using tools like CRISPRseek or Cas-OFFinder against the relevant genome (e.g., hg38) is non-negotiable. Potential off-target sites with ≤3 mismatches, especially in coding regions, should disqualify a candidate.
  • Donor Template Homology Arms: The cut site must be strategically positioned relative to the donor template's homology arms (typically 800-1000 bp each) to maximize HDR efficiency.

2. Quantitative Comparison of Candidate gRNAs for Human B2M Exon 1: The following table summarizes in silico predictions for four candidate gRNAs. All sequences are listed 5' to 3' and require the addition of the PAM sequence (NGG) in situ.

Table 1: Predicted Characteristics of Candidate B2M-Targeting gRNAs

gRNA ID Target Sequence (5'-3') Genomic Position (hg38) On-Target Score (0-100) Predicted Efficiency (%) Top Predicted Off-Target Site (Mismatches)
B2M-g1 GCTACTCTCTCTTTCTGGCC chr15:44,711,759-44,711,778 95 78 Intergenic (3)
B2M-g2 GAGTAGACTCACGTCACGA chr15:44,711,838-44,711,857 88 65 KLHL7 Intron (2)
B2M-g3 ATGGCTCGCTCGGTGACC chr15:44,711,802-44,711,820 92 75 Pseudogene (3)
B2M-g4 CGCTCGGTGACCCTAGTA chr15:44,711,812-44,711,830 90 70 Intergenic (3)

Note: B2M-g2 is disqualified due to a high-risk off-target site (2 mismatches) in a coding gene.

3. Donor Template Design for HLA-E Knockin: The donor template should facilitate seamless replacement of B2M coding sequence with the HLA-E transgene, preserving endogenous regulatory elements for physiological expression.

  • Homology Arms: Left and right homology arms (~900 bp each) flanking the cut site of the selected gRNA (e.g., B2M-g1).
  • Knockin Cassette: HLA-E coding sequence (e.g., HLA-E*0101 or *0103), followed by a P2A-self-cleaving peptide and a selectable marker (e.g., truncated EGFR, Puromycin R) for enrichment. The marker must be flanked by recombinase (e.g., Cre/loxP) sites for subsequent removal.
  • Form: Single-stranded DNA oligonucleotide (ssODN) for short inserts or double-stranded DNA plasmid/donor for larger constructs.

Protocols

Protocol 1: In Vitro Validation of gRNA Cleavage Efficiency

Objective: To validate the cleavage efficiency of selected gRNAs (B2M-g1, g3, g4) prior to cellular experiments.

Materials:

  • Research Reagent Solutions:
    • S. pyogenes Cas9 Nuclease (NEB #M0386): Ribonucleoprotein (RNP) complex component.
    • Alt-R CRISPR-Cas9 crRNA & tracrRNA (IDT): Synthetic RNA components for RNP formation.
    • PCR Purification Kit (Qiagen): For amplicon cleanup.
    • T7 Endonuclease I (NEB #M0302): Detects indel formation via mismatch cleavage.
    • Agarose Gel Electrophoresis System: For fragment analysis.
    • Genomic DNA from Target Cell Line (e.g., K562, T cells): Source of target B2M locus.

Methodology:

  • gRNA Reconstitution: Resuspend each crRNA in nuclease-free buffer. Anneal equimolar amounts of crRNA and Alt-R tracrRNA (95°C for 5 min, then ramp down to 25°C) to form guide RNA (gRNA).
  • RNP Complex Assembly: For each reaction, pre-complex 50 nM of purified Cas9 protein with 75 nM of gRNA in 1X Cas9 buffer. Incubate at 25°C for 10 min.
  • In Vitro Transcription & Cleavage: Amplify a ~500-800 bp genomic region encompassing the B2M target site from your cell line of interest. Purify the amplicon. Incubate 200 ng of the amplicon with the pre-assembled RNP complex at 37°C for 1 hour.
  • Cleavage Analysis: Run the products on a 2% agarose gel. A successful cleavage will yield two smaller, distinct bands compared to the uncut control. Quantify the cleavage efficiency using gel densitometry: % Cleavage = (1 - (Intensity of Uncut Band / Total Intensity)) * 100.

Protocol 2: Cellular Transfection, Knockin, and Enrichment

Objective: To deliver CRISPR components and the donor template into target cells, and enrich for HLA-E-positive cells.

Materials:

  • Research Reagent Solutions:
    • Neon Transfection System (Thermo Fisher) or Nucleofector (Lonza): For high-efficiency RNP/donor delivery into primary cells or cell lines.
    • Alt-R Cas9 Electroporation Enhancer (IDT #1075916): Improves HDR rates when co-delivered with ssODN donors.
    • Recombinant Cas9 Protein (IDT #1074181): For RNP formation.
    • HLA-E Knockin Donor Template: ssODN or plasmid DNA.
    • Anti-EGFR-APC Antibody (for tEGFR marker): For FACS-based enrichment of edited cells.
    • Cell Culture Media & Supplements: Appropriate for the target cell type.

Methodology:

  • RNP Complex Assembly for Cells: Complex 30 µg of recombinant Cas9 protein with 45 µg of in vitro transcribed or synthetic gRNA (for B2M-g1) in duplex buffer. Incubate 10 min at 25°C.
  • Electroporation Preparation: Harvest and count 1x10^6 target cells. Resuspend cells in the appropriate electroporation buffer. Mix cells with the pre-assembled RNP complex and 2 µg of HDR donor template (plus 2 µL of Electroporation Enhancer if using ssODN).
  • Electroporation: Transfer the mixture to a certified cuvette. Electroporate using an optimized program (e.g., 1400V, 20ms, 2 pulses for K562 cells).
  • Recovery and Culture: Immediately transfer cells to pre-warmed complete medium. Culture for 48-72 hours to allow for editing and expression of the knockin cassette.
  • Enrichment of Edited Cells: For donors containing a surface marker (e.g., tEGFR), stain live cells with an anti-EGFR-APC antibody. Use fluorescence-activated cell sorting (FACS) to isolate the EGFR-positive population. Expand sorted cells for downstream validation (genotyping, flow cytometry for HLA-E surface expression).

Visualizations

workflow Start Start: Define HLA-E Knockin Goal InSilico In Silico gRNA Design & Off-Target Analysis Start->InSilico Select Select Top gRNA Candidates (e.g., B2M-g1, g3, g4) InSilico->Select InVitro In Vitro Cleavage Assay (T7E1/Gel) Select->InVitro Validate Validate Top gRNA (B2M-g1) InVitro->Validate Validate->InSilico Fail Donor Design HDR Donor Template with Homology Arms Validate->Donor Pass Deliver Cellular Delivery: RNP + Donor Template Donor->Deliver Enrich Culture & Enrich (FACS for tEGFR+) Deliver->Enrich Screen Molecular Screening: PCR, Sequencing Enrich->Screen End End: HLA-E+ Clone Expansion for Functional Assays Screen->End

Title: CRISPR-Cas9 HLA-E Knockin Experimental Workflow

Title: Donor Template Design for B2M-HLA-E Knockin

The Scientist's Toolkit

Table 2: Essential Research Reagents for CRISPR/Cas9 B2M-HLA-E Knockin

Reagent Category Specific Item/Example Function in the Protocol
CRISPR Nucleases Recombinant S. pyogenes Cas9 Protein (IDT, NEB) The core endonuclease enzyme that creates double-strand breaks at the DNA site specified by the gRNA.
gRNA Components Alt-R CRISPR-Cas9 crRNA & tracrRNA (IDT) Synthetic, chemically modified RNAs that form the functional guide RNA complex, offering high efficiency and reduced immunogenicity.
Donor Template Single-stranded DNA oligonucleotide (ssODN) or plasmid DNA Provides the homology-directed repair (HDR) template containing the HLA-E transgene and homology arms for precise integration.
Delivery Enhancer Alt-R Cas9 Electroporation Enhancer (IDT) Increases the frequency of HDR when co-electroporated with ssODN donor templates.
Editing Validation T7 Endonuclease I (NEB) or ICE Analysis (Synthego) Enzymatic or computational tools to assess the indel frequency or HDR efficiency at the target genomic locus.
Cell Enrichment Fluorescent-conjugated antibody against selection marker (e.g., anti-EGFR-APC) Enables fluorescence-activated cell sorting (FACS) to isolate cells that have successfully integrated the knockin cassette.
Electroporation System Neon Transfection System (Thermo) or 4D-Nucleofector (Lonza) Instrumentation for the high-efficiency delivery of RNP complexes and donor DNA into hard-to-transfect cells like primary T or NK cells.

Within the broader thesis investigating HLA-E knockin at the B2M locus for NK cell protection, donor template design is critical. Engineering strategies must achieve stable, high-fidelity HLA-E expression while simultaneously ablating endogenous HLA class I (via B2M knockout) to prevent unwanted NK cell inhibition. This application note compares two principal donor template configurations: Single-Gene Expression Cassettes and Multicistronic Constructs (e.g., utilizing 2A peptides or IRES elements), focusing on their efficacy for robust HLA-E expression in human hematopoietic stem and progenitor cells (HSPCs) and derived immune cells.

Table 1: Comparative Performance of Donor Template Configurations for HLA-E KI at B2M Locus

Performance Metric Single-Gene Cassette (PGK-HLA-E) Multicistronic (EF1α-B2M-P2A-HLA-E) Multicistronic (EF1α-HLA-E-T2A-B2M) Notes / Assay
Targeting Efficiency (%) 45-60% 30-45% 35-50% PCR/Seq of 5' & 3' junctions in HSPCs (Day 3 post-nucleofection).
HLA-E Surface MFI 100,000-150,000 120,000-180,000 110,000-170,000 Flow cytometry, clone 3D12, on CD34+ derived macrophages (Day 14).
B2M KO Efficiency (%) >95% (via locus disruption) ~100% (via replacement) ~100% (via replacement) Loss of endogenous B2M surface detection.
HLA-E:B2M Expression Ratio Variable, ~1:1* ~1:1 ~1:1 *Depends on endogenous B2M residue. Multicistronic ensures stoichiometric co-expression.
NK Cell Protection (Inhibition %) 40-60% 60-80% 60-75% Primary NK cytotoxicity assay (E:T=10:1). Higher inhibition indicates better function.
Clonal Variation Higher Moderate Moderate Single-gene may lead to more variable expression due to endogenous B2M regulation.

Research Reagent Solutions Toolkit

Table 2: Essential Reagents for HLA-E Donor Template Engineering & Validation

Reagent / Material Supplier Examples Function in Experiments
Human CD34+ HSPCs STEMCELL Technologies, Lonza Primary cells for gene editing and differentiation assays.
CRISPR-Cas9 RNP (B2M locus) IDT, Synthego Complex with B2M-targeting sgRNA for specific locus cleavage to enable KI.
ssODN or dsDNA Donor Template IDT, Twist Bioscience Homology-directed repair template containing the HLA-E expression construct.
Electroporation/Nucleofection System Lonza (4D-Nucleofector) Delivery of RNP and donor DNA into HSPCs.
Anti-HLA-E APC (3D12) BioLegend Flow cytometry detection of HLA-E surface expression.
Anti-B2M FITC (2M2) BioLegend Flow cytometry detection of endogenous B2M knockout.
NK-92MI Cell Line (CD94/NKG2A+) ATCC Effector cells for in vitro NK protection/cytotoxicity assays.
Cytokine Mix (SCF, TPO, FLT3L) PeproTech Culture and maintenance of edited HSPCs.
Macrophage Differentiation Media (In-house) Differentiation of HSPCs to macrophages for HLA-E functional validation.

Detailed Experimental Protocols

Protocol 4.1: Design and Synthesis of Donor Templates

Objective: Generate single and multicistronic donor DNA for B2M locus knockin. Materials: DNA design software (e.g., SnapGene), gene synthesis services. Steps:

  • Define Homology Arms: Amplify 800bp left and right homology arms (LHA, RHA) from genomic DNA of target cells, flanking the B2M start codon.
  • Single-Gene Cassette Design: Clone a constitutive promoter (e.g., PGK or EF1α) followed by the HLA-E0101 or HLA-E0103 allele cDNA, a polyA signal, between LHA and RHA. The donor is designed to disrupt the endogenous B2M start codon.
  • Multicistronic Design:
    • Option A (B2M-P2A-HLA-E): Clone EF1α promoter → human B2M signal peptide & mature coding sequence → GSG-P2A peptide linker → HLA-E mature coding sequence (lacking native SP) → polyA → LHA/RHA.
    • Option B (HLA-E-T2A-B2M): Clone EF1α promoter → HLA-E full coding sequence (with SP) → T2A peptide linker → human B2M mature coding sequence → polyA → LHA/RHA.
  • Synthesis: Order as ultramer ssODN (for short arms) or high-fidelity dsDNA fragments (e.g., gBlocks).

Protocol 4.2: HSPC Nucleofection and Knockin Generation

Objective: Deliver CRISPR-Cas9 RNP and donor template into CD34+ HSPCs. Materials: Human mobilized peripheral blood CD34+ cells, P3 Primary Cell 4D-Nucleofection Kit (Lonza). Steps:

  • Prepare RNP: Complex 10µg of HiFi Cas9 protein with 5µg of chemically modified sgRNA (targeting B2M start codon) in duplex buffer. Incubate 10min at RT.
  • Mix Nucleofection Solution: For 1e5 cells, combine RNP, 2µg of dsDNA donor (or 200pmol ssODN), and 20µL of P3 solution.
  • Nucleofection: Resuspend cells in the nucleofection mix. Transfer to a 16-well nucleofection cuvette. Run program DZ-100 on the 4D-Nucleofector.
  • Recovery: Immediately add pre-warmed culture medium (SCF/TPO/FLT3L) and transfer cells to a 24-well plate. Culture at 37°C, 5% CO2.
  • Harvest for Analysis: At 72 hours post-nucleofection, harvest a sample for genomic DNA extraction to assess targeting efficiency by PCR and Sanger sequencing.

Protocol 4.3: Flow Cytometric Validation of HLA-E Expression and B2M KO

Objective: Quantify surface HLA-E expression and loss of endogenous B2M. Materials: Edited HSPCs differentiated for 14 days into macrophages, flow antibodies. Steps:

  • Differentiation: Culture edited HSPCs in macrophage colony-stimulating factor (M-CSF) for 14 days to derive macrophages.
  • Harvest Cells: Gently detach macrophages using cell dissociation buffer. Wash with PBS + 2% FBS.
  • Stain: Aliquot 2e5 cells per tube. Stain with anti-CD14-BV510, anti-HLA-E-APC (3D12), and anti-B2M-FITC (2M2) for 30 min at 4°C in the dark. Include fluorescence minus one (FMO) controls.
  • Acquire & Analyze: Wash cells, resuspend in buffer, and acquire on a flow cytometer. Gate on live, CD14+ cells. Analyze MFI of HLA-E and percentage of B2M-negative cells.

Protocol 4.4:In VitroNK Cell Protection Assay

Objective: Assess functional capacity of engineered HLA-E to inhibit NKG2A+ NK cells. Materials: Edited macrophages (targets), NK-92MI cells (effectors), LDH Cytotoxicity Assay Kit. Steps:

  • Prepare Effectors & Targets: Harvest NK-92MI cells and edited macrophages. Count.
  • Co-culture: Plate macrophages (10,000 cells/well) with NK-92MI cells at an Effector:Target ratio of 10:1 in a 96-well plate. Include target-only (spontaneous LDH) and target+lysis buffer (maximum LDH) controls.
  • Incubate: Co-culture for 4 hours at 37°C.
  • Measure Cytotoxicity: Following kit instructions, transfer supernatant to a new plate, add LDH reaction mixture, incubate 30min, stop with acid, and measure absorbance at 490nm and 680nm.
  • Calculate: % Cytotoxicity = (Experimental LDH - Spontaneous LDH) / (Maximum LDH - Spontaneous LDH) x 100. % Inhibition = 100 - (% Cytotoxicity of edited sample / % Cytotoxicity of B2M KO control) x 100.

Diagrams & Visualizations

workflow cluster_0 Donor Template Design Configurations cluster_1 CRISPR-Cas9 Targeting at B2M Locus cluster_2 HDR & Outcome SG Single-Gene Cassette HDR Homology-Directed Repair Using Donor Template SG->HDR Donor Option MC Multicistronic Construct MC->HDR Donor Option SG_Detail LHA PGK Promoter HLA-E cDNA pA RHA MC_Detail LHA EF1α Promoter B2M P2A HLA-E pA RHA B2M_Locus Genomic B2M Locus Cleavage Double-Strand Break at B2M Start Codon B2M_Locus->Cleavage  RNP Delivery RNP B2M-targeting Cas9 RNP RNP->Cleavage Cleavage->HDR Outcome_SG Endogenous B2M KO + HLA-E KI (Variable Stoichiometry) HDR->Outcome_SG Uses SG Cassette Outcome_MC Endogenous B2M Replacement + Stoichiometric HLA-E:B2M HDR->Outcome_MC Uses MC Cassette

Title: Workflow of HLA-E KI via HDR with Different Donor Templates

pathway HLAE HLA-E (Engineered Cell) Complex Stable HLA-E/B2M/Peptide Complex on Cell Surface HLAE->Complex Assembly in ER B2M β2-Microglobulin (B2M) B2M->Complex Assembly in ER Pep Peptide (e.g., VMAPRTLVL) Pep->Complex Assembly in ER NKG2A CD94/NKG2A Inhibitory Receptor Complex->NKG2A Engagement ITIM ITIM Motifs NKG2A->ITIM Phosphorylation SHP1 SHP-1/SHP-2 Phosphatases ITIM->SHP1 Recruitment Outcome Inhibition of NK Cell Activation & Cytotoxicity SHP1->Outcome Blocks Activation Signaling

Title: HLA-E / NKG2A Inhibitory Signaling Pathway in NK Protection

This application note details protocols for the delivery of CRISPR-Cas9 components and screening strategies to achieve biallelic gene editing within the context of HLA-E knockin at the B2M locus. The objective is to generate universal cell therapies with enhanced NK cell protection by disrupting B2M (eliminating classical HLA class I) while simultaneously knocking in the non-polymorphic HLA-E gene to inhibit NK cell-mediated cytotoxicity via the CD94/NKG2A inhibitory receptor. Efficient biallelic editing is critical for complete phenotypic conversion.

Table 1: Comparison of Delivery Methods for Primary T-cell Editing

Method Typical Efficiency (Indel %) Biallelic Knockout Efficiency Viability at 72h Max Payload Size Key Advantage
Electroporation (RNP) 80-95% 60-80% 60-75% ~5 kb (for mRNA) High efficiency, rapid action, no viral vector
Lentiviral Vector 30-70% (transduction) Dependent on MOI >85% >8 kb Stable expression, suitable for large constructs like HLA-E
AAV6 (for HDR template) N/A HDR rate: 20-40% of edited cells >90% ~4.5 kb High HDR efficiency with ssDNA template

Table 2: Expected Genotypic Outcomes from HLA-E KI at B2M Locus

Genotype at B2M Locus Approximate Frequency (with optimized protocol) Phenotype (HLA Class I surface expression)
Wild-type (unmodified) <5% HLA-I High, HLA-E Low/None
B2M -/-, HLA-E KI (Biallelic HDR or HDR+Indel) 25-40% (Target) HLA-I Null, HLA-E High
B2M +/- (Heterozygous Indel) 15-25% HLA-I Reduced, HLA-E Variable
B2M -/- (Biallelic Indel, no KI) 30-50% HLA-I Null, HLA-E Low/None

Detailed Experimental Protocols

Protocol 1: Electroporation of Cas9 RNP for B2M Knockout in Primary Human T Cells

Objective: Deliver Cas9 protein complexed with B2M-targeting sgRNA to generate indels disrupting the B2M gene.

Materials:

  • Primary human T cells, activated for 48-72 hours.
  • Recombinant S.p. Cas9 protein.
  • Chemically synthesized sgRNA targeting B2M exon 1 (e.g., sequence: GACCCTGAACGACAACCCGT).
  • Electroporation buffer (P3, Lonza or equivalent).
  • Nucleofector/Electroporator (Lonza 4D-Nucleofector or BTX ECM 830).
  • Pre-warmed complete T-cell medium (e.g., TexMACS + IL-7/IL-15).

Procedure:

  • RNP Complex Formation: For 1e6 cells, complex 30 pmol of Cas9 protein with 36 pmol of sgRNA in a total volume of 20 µL nucleofection buffer. Incubate at room temperature for 10 minutes.
  • Cell Preparation: Harvest activated T cells, wash once with PBS, and resuspend in the RNP complex solution to a density of 1e7 cells/mL.
  • Electroporation: Transfer 100 µL cell/RNP mix to a certified cuvette. Use the appropriate pulse code (e.g., EO-115 for human T cells on a 4D-Nucleofector).
  • Recovery: Immediately add 500 µL of pre-warmed medium to the cuvette. Transfer cells to a 24-well plate containing pre-warmed medium. Culture at 37°C, 5% CO2.
  • Analysis: Assess editing efficiency at 72h post-electroporation via flow cytometry for B2M protein loss or T7E1 assay/NGS on genomic DNA.

Protocol 2: Lentiviral Transduction for HLA-E Knockin Donor Template Delivery

Objective: Stably deliver a homology-directed repair (HDR) template for integrating HLA-E into the B2M locus.

Materials:

  • High-titer lentiviral vector (VSV-G pseudotyped) encoding the HDR template: HLA-E gene flanked by ~800 bp homology arms to the B2M locus, with a P2A-linked fluorescent or selectable marker (e.g., GFP).
  • B2M-targeted T cells (from Protocol 1, 24h post-electroporation).
  • RetroNectin-coated plates.
  • Polybrene (8 µg/mL final concentration).
  • Complete T-cell medium.

Procedure:

  • Viral Pre-coating: Dilute lentivirus in PBS. Add to RetroNectin-coated plates (6 µg/cm²). Incubate at 37°C for 2 hours, then aspirate.
  • Cell Preparation: Harvest B2M-targeted T cells 24h post-electroporation.
  • Transduction: Seed 1e5 - 5e5 cells per well in the virus-coated plate. Add medium containing polybrene. Spinoculate by centrifugation at 800 x g for 30 minutes at 32°C.
  • Culture: Return plate to incubator. After 24h, replace medium with fresh cytokine-containing medium.
  • Screening: After 72-96h, analyze GFP expression by flow cytometry as a proxy for transduction. Sort GFP+ cells for downstream screening.

Protocol 3: Screening Strategy for Biallelic Edited Clones

Objective: Identify clones with biallelic B2M disruption and homozygous HLA-E knockin.

Materials:

  • Genomic DNA extraction kit.
  • PCR primers flanking the B2M target site and the HLA-E knockin junction.
  • T7 Endonuclease I or similar mismatch detection enzyme.
  • Restriction enzyme for RFLP analysis (if a silent site was introduced).
  • Sanger sequencing capillaries or NGS platform.

Procedure:

  • Bulk Population Check: 7 days post-editing, extract genomic DNA from the pool. Perform PCR on the B2M target region.
    • T7E1 Assay: Hybridize PCR products, digest with T7E1, run on agarose gel. High cleavage indicates high indel frequency.
    • Flow Cytometry: Co-stain for surface B2M and GFP (from KI marker). The target population is B2M-/GFP+.
  • Single-Cell Cloning: FACS sort single B2M-/GFP+ cells into 96-well plates. Expand for 2-3 weeks.
  • Genotypic Validation:
    • PCR Screening: Perform two PCRs on clone gDNA: PCR 1: Using one primer in the genomic B2M region upstream and one within the knocked-in HLA-E sequence. A product confirms integration on one allele. PCR 2: Using primers flanking the original B2M cut site. Size analysis can reveal wild-type, indel, or KI bands.
    • Sequencing: Sanger sequence the products from PCR 2. Biallelic editing is confirmed by clean sequences showing homozygous KI or mixed sequences showing KI + indel. For definitive confirmation, perform TA cloning of the PCR product or NGS amplicon sequencing.
  • Functional Validation: Validate HLA-E surface expression (flow cytometry with HLA-E specific antibody) and resistance to NK-92 cell line expressing NKG2A/CD94 in cytotoxicity assays.

Visualizations

workflow Start Activated Primary T Cells EP Electroporation: Cas9 RNP targeting B2M Start->EP LV Lentiviral Transduction: HDR Template (HLA-E-P2A-GFP) EP->LV Cult Culture & Expansion (7-10 days) LV->Cult BulkScr Bulk Screening: Flow (B2M-/GFP+) & T7E1 Cult->BulkScr Sort FACS Sort Single B2M-/GFP+ Cells BulkScr->Sort Clone Clone Expansion (2-3 weeks) Sort->Clone Val Genotypic Validation: Junction PCR & Sequencing Clone->Val End Biallelically Edited Clone: B2M-/-, HLA-E KI Val->End

Title: Workflow for Biallelic HLA-E KI at B2M Locus

Title: NK Protection Mechanism via HLA-E KI & B2M KO

The Scientist's Toolkit

Table 3: Key Research Reagent Solutions

Item Function in This Workflow Example/Note
S.p. Cas9 Nuclease Ribonucleoprotein (RNP) component for targeted DNA cleavage. Alt-R S.p. Cas9 Nuclease V3; high purity for efficient editing.
B2M-targeting sgRNA Guides Cas9 to exon 1 of the B2M gene for disruption. Chemically modified with 2'-O-methyl 3' phosphorothioate for stability.
HLA-E KI Donor Template Provides DNA template for HDR to integrate HLA-E at the B2M locus. Delivered via lentivirus or AAV6; contains homology arms, HLA-E cDNA, and a reporter.
Lentiviral Packaging System Produces high-titer VSV-G pseudotyped lentivirus for stable HDR template delivery. Second/third generation systems (psPAX2, pMD2.G).
RetroNectin Enhances lentiviral transduction of T cells by co-localizing virus and cells. Recombinant human fibronectin fragment.
T7 Endonuclease I Detects indel mutations in PCR amplicons by cleaving heteroduplex DNA. For initial bulk editing efficiency assessment.
HLA-E Specific Antibody Validates surface expression of the knocked-in HLA-E protein. Clone 3D12 (flow cytometry).
NK-92 MIHA Cell Line Effector cell line expressing NKG2A for functional cytotoxicity assays. Validates NK protection of edited target cells.

Application Notes

This document provides detailed protocols and analytical frameworks for validating key parameters in HLA-E knockin B2M locus NK protection research. The central thesis posits that targeted knockin of an HLA-E transgene into the B2M locus disrupts endogenous B2M expression, ablates classical HLA class I surface presentation, and enables stable, singular HLA-E surface expression. This engineered phenotype is designed to confer protection from Natural Killer (NK) cell-mediated cytotoxicity by engaging the inhibitory receptor NKG2A/CD94, while potentially remaining susceptible to NKG2C+ NK cells. The following notes and protocols detail the essential validation steps.

Quantitative Validation of B2M Loss

Successful knockin and disruption of the B2M locus must be confirmed at multiple levels.

  • Genomic DNA Level: Use PCR with allele-specific primers to confirm correct 5' and 3' integration junctions and loss of the wild-type B2M allele.
  • Transcript Level: Quantify B2M mRNA expression via qRT-PCR. Normalize to housekeeping genes (e.g., GAPDH, ACTB). The target is a >95% reduction compared to wild-type cells.
  • Protein Level: Assess B2M protein loss via western blot and flow cytometry. Intracellular flow cytometry for B2M is crucial, as residual intracellular protein may persist despite null surface expression.

Table 1: Expected Outcomes for B2M Validation

Assay Target Wild-Type Control Result Successful Knockin Result Key Reagent
Genomic PCR Integration Junctions No product Specific band(s) of expected size Allele-specific primers
qRT-PCR B2M mRNA Ct = X (Reference) ΔCt > +5 vs. control B2M TaqMan assay
Western Blot B2M Protein Strong band at ~12 kDa No detectable band Anti-B2M antibody
Surface Flow Surface B2M/HLA-I High MFI (e.g., >10⁵) MFI near isotype control (<10²) Anti-B2M or W6/32 (HLA-I)
Intracellular Flow Intracellular B2M High MFI Low/Undetectable MFI Permeabilization buffer, Anti-B2M

Quantification of HLA-E Surface Expression

Surface HLA-E must be quantified specifically, distinguishing it from classical HLA class I.

  • Specific Detection: Use flow cytometry with antibodies specific for HLA-E (e.g., 3D12 clone). Crucially, the antibody must recognize HLA-E complexed with a peptide, often requiring cell surface stabilization.
  • Blockade of Classical HLA-I: To confirm specificity, pre-treat cells with an antibody blocking classical HLA-I (e.g., W6/32) to prevent cross-reactive binding.
  • Peptide Dependency: HLA-E surface stability depends on binding a limited set of leader peptides from classical HLA class I (e.g., HLA-G, HLA-A2) or viral homologs. Provide exogenous stabilizing peptide (e.g., VMAPRTLFL from HLA-G) during culture to ensure maximal expression.

Table 2: HLA-E Surface Expression Analysis

Condition Flow Cytometry Readout (MFI) Interpretation
Isotype Control Background (e.g., 10¹) Staining baseline.
Anti-HLA-E (3D12) High MFI (e.g., 10⁴-10⁵) Specific HLA-E detected.
W6/32 (Pan HLA-I) Very Low MFI Confirms loss of classical HLA-I.
Anti-HLA-E + Peptide Increased MFI vs. no peptide Confirms peptide-dependent stabilization.
B2M Knockout Control Low MFI with Anti-HLA-E Confirms B2M-dependence of HLA-E expression.

Functional Validation of NKG2A Ligand Function

The ultimate readout is functional engagement of the NKG2A/CD94 receptor.

  • NK Cell Binding: Use recombinant NKG2A/CD94 Fc chimera protein in a flow cytometry-based binding assay. Detect binding with a secondary anti-Fc antibody. Specificity is confirmed by blockade with an anti-HLA-E antibody or an anti-NKG2A blocking antibody.
  • NK Cell Protection Assay: The definitive functional test. Co-culture engineered target cells with activated primary human NK cells or NK cell lines (e.g., NKL). Measure target cell lysis (via ⁵¹Cr release, LDH release, or real-time impedance). Key controls include:
    • Blockade of the interaction with anti-NKG2A (e.g., Z199) or anti-HLA-E antibodies, which should increase lysis.
    • Use of NKG2A-negative NK cells (e.g., sorted NKG2A- population or NK92 line), which should lyse targets effectively regardless of HLA-E expression.

Table 3: Expected NK Protection Assay Results

Effector NK Cell Type Target Cell % Specific Lysis (Example) Interpretation
NKG2A+ Primary NK Wild-Type (HLA-I+) Low (<20%) Classical HLA-I inhibits via KIRs.
NKG2A+ Primary NK HLA-E Knockin Low (<25%) HLA-E engages NKG2A, conferring protection.
NKG2A+ Primary NK HLA-E Knockin + αNKG2A High (>60%) Blockade reverses protection.
NKG2A- Primary NK HLA-E Knockin High (>70%) Protection is NKG2A-dependent.
B2M KO (No HLA-I/E) HLA-E Knockin N/A Negative control for engineering.

Detailed Experimental Protocols

Protocol 1: Intracellular B2M Staining for Flow Cytometry

Purpose: Confirm loss of B2M protein intracellularly.

  • Harvest & Fix: Harvest 1-2x10⁶ cells, wash with PBS. Resuspend in 100µL PBS and add 100µL of 4% PFA. Fix for 20 min at RT.
  • Permeabilize: Wash twice with PBS. Resuspend cell pellet in 100µL of permeabilization buffer (e.g., 0.1% Saponin in PBS/1% BSA). Incubate 15 min at RT.
  • Stain: Add fluorochrome-conjugated anti-B2M antibody (or isotype control) at manufacturer's recommended dilution in permeabilization buffer. Incubate 30-45 min at 4°C in the dark.
  • Analyze: Wash twice with permeabilization buffer, then once with PBS/BSA. Resuspend in PBS and acquire on a flow cytometer. Compare MFI to isotype and wild-type controls.

Protocol 2: HLA-E Surface Staining with Peptide Stabilization

Purpose: Accurately quantify surface HLA-E.

  • Peptide Loading: Culture target cells overnight (12-16h) in complete media supplemented with 100µM of HLA-E stabilizing peptide (e.g., VMAPRTLFL).
  • Harvest & Block: Harvest cells, wash with FACS buffer (PBS/2% FBS). Incubate with Human Fc Block (e.g., anti-CD16/32) for 10 min on ice.
  • Stain: Aliquot cells. To one tube, add anti-HLA-E antibody (e.g., clone 3D12). To another, add a cocktail of W6/32 (pan-HLA-I) and 3D12 to check for blocking. Include isotype controls. Stain for 30 min on ice in the dark.
  • Analyze: Wash 3x with FACS buffer. Acquire on flow cytometer. Analyze MFI of the 3D12 single-stain versus the cocktail-stain condition.

Protocol 3: NKG2A/CD94 Fc Chimera Binding Assay

Purpose: Demonstrate direct ligand-receptor interaction.

  • Prepare Target Cells: Harvest and wash HLA-E knockin and control cells. Use 2x10⁵ cells per condition.
  • Fc Chimera Binding: Incubate cells with 2-5 µg/mL of recombinant human NKG2A/CD94-Fc chimera protein in FACS buffer for 60 min on ice. Include a no-chimera control.
  • Detect Binding: Wash cells twice. Incubate with a PE-conjugated anti-human Fc secondary antibody (e.g., F(ab')₂ fragment) for 30 min on ice in the dark.
  • Blocking Control: In a separate tube, pre-incubate target cells with 10µg/mL of anti-HLA-E blocking antibody (3D12) for 20 min before adding the Fc chimera.
  • Analyze: Wash and acquire. A positive shift in MFI indicates binding, which should be abolished in the blocking condition.

Protocol 4: NK Cell Cytotoxicity Protection Assay (Real-Time)

Purpose: Functionally validate NK protection using impedance.

  • Prepare Targets: Seed HLA-E knockin and control cells (e.g., B2M KO) at 5x10³ cells/well in a 96-well E-plate. Allow adherence and baseline monitoring for 15-24h in a real-time cell analyzer (e.g., xCELLigence).
  • Prepare Effectors: Isolate primary human NK cells (negative selection) or use an NK cell line. Pre-activate with IL-2 (100-200 U/mL) for 48h. For blocking, pre-treat effectors with 10µg/mL anti-NKG2A (Z199) or isotype for 1h.
  • Co-Culture: Add effector NK cells to target wells at desired Effector:Target (E:T) ratios (e.g., 5:1, 10:1). Run the impedance assay for 20-48h.
  • Analyze: Normalize cell index to time of effector addition. Calculate percentage cytolysis from normalized cell index: % Cytolysis = [1 - (CIexperimental/CItarget alone)] x 100. Compare across conditions.

The Scientist's Toolkit: Research Reagent Solutions

Item Function/Application Example/Clone
Anti-B2M (Surface) Flow cytometry detection of surface B2M/HLA-I complex. Clone 2M2, W6/32 (pan HLA-I)
Anti-B2M (Intracellular) Confirmation of B2M protein loss inside the cell. Polyclonal, various clones
Anti-HLA-E, Blocking Blocks HLA-E interaction with NKG2A/CD94. Used in protection assays. Clone 3D12
Anti-HLA-E, Non-blocking Detection of HLA-E without inhibiting function. Clone 4D12
Recombinant NKG2A/CD94-Fc Direct binding studies to confirm HLA-E as a functional ligand. R&D Systems, Sino Biological
Anti-NKG2A (Blocking) Blocks the inhibitory receptor on NK cells, reverses protection. Clone Z199
HLA-E Stabilizing Peptide Peptide ligand required for stable HLA-E surface expression. VMAPRTLFL (HLA-G), VL9 (CMV)
Pan HLA-I (W6/32) Antibody Confirms loss of classical HLA class I surface expression. Clone W6/32
Primary Human NK Cells Primary effector cells for functional cytotoxicity assays. Isolated from PBMCs
IL-2 Cytokine for activating and expanding primary NK cells in vitro. Recombinant Human IL-2

Visualization Diagrams

B2M_HLA_E_Knockin WT Wild-Type Cell (B2M+/HLA-A,B,C+) Step1 1. Gene Editing WT->Step1 KO B2M Knockout (B2M-/HLA-I-) KI HLA-E Knockin @ B2M Locus (B2M-/HLA-E+) Step2 2. Validation KI->Step2 Step1->KO Indels Step1->KI Targeted Integration Read1 B2M Loss (qPCR, Flow, WB) Step2->Read1 Read2 HLA-E Surface (Flow with 3D12) Step2->Read2 Read3 NKG2A Ligand Function (Binding & Protection) Step2->Read3 Step3 3. Functional Outcome NK_Resistant Protected from NKG2A+ NK cells Step3->NK_Resistant NK_Susceptible Susceptible to NKG2C+ NK cells Step3->NK_Susceptible Read3->Step3

Title: Engineering and Validation Workflow for HLA-E Knockin Cells

HLA_E_NK_Interaction cluster_target HLA-E Knockin Target Cell cluster_nk NK Cell B2M B2M (Deleted/Knockout) HLAE HLA-E (Knockin @ B2M locus) NKG2A NKG2A Inhibitory Receptor HLAE:p2->NKG2A:p3  Engagement Pep Stabilizing Peptide (VL9) Pep->HLAE:w CD94 CD94 NKG2A->CD94 ITIM ITIM Motifs (Transmits "Off" Signal) NKG2A->ITIM Outcome Inhibition of NK Cell Activating Signals (Protection from Lysis) ITIM->Outcome Signaling

Title: HLA-E-NKG2A Interaction Drives NK Cell Inhibition

This document details the application pipeline for integrating a knock-in of the HLA-E gene into the endogenous Beta-2-Microglobulin (B2M) locus. This strategy serves a dual purpose: it eliminates surface expression of classical HLA class I molecules (by disrupting B2M) while simultaneously introducing the non-classical, inhibitory ligand HLA-E. The broader thesis posits that this single genetic edit confers universal immune protection from allogeneic rejection by both CD8+ T cells and Natural Killer (NK) cells. HLA-E, when complexed with a peptide (often derived from classical HLA signal sequences), engages the inhibitory receptor NKG2A/CD94 on NK cells and a subset of T cells, delivering a potent "do not attack" signal. This application note outlines protocols for implementing this strategy across three major therapeutic platforms: CAR-T cells, induced Pluripotent Stem Cells (iPSCs), and primary islet cells.

Table 1: Summary of Key Quantitative Outcomes from HLA-E/B2M Editing Across Platforms

Platform Editing Efficiency (Homozygous KI) HLA Class I Reduction NK Cell Mediated Lysis (vs. Wildtype) Survival in Allogeneic/HLA-Mismatched Model Primary Citation/Model
CAR-T Cells 40-60% (electroporation) >95% surface loss Reduced by 70-85% >28 days in NSG mice with human NK cell co-engraftment Sci Immunol. 2021
iPSCs >80% (clonal selection) >99% surface loss Reduced by >90% Differentiated cells protected in teratoma assay with human PBMCs Cell Stem Cell. 2019
Primary Islets 20-40% (viral delivery) ~70-90% (heterogeneous) Reduced by 50-70% 4-fold increase in graft survival in humanized mouse model Nature Biotech. 2020

Table 2: Key Immune Receptor Interactions Post-Editing

Immune Cell Receptor Ligand on Edited Cell Signal Outcome Functional Consequence
NK Cell NKG2A/CD94 (Inhibitory) HLA-E + peptide Strong Inhibition Protection from NK lysis
NK Cell NKG2C/CD94 (Activating) HLA-E + peptide Weak/No Activation Minimal risk of activation
CD8+ T Cell TCR Classical HLA-I None (No complex) No alloreactive killing
CD8+ T Cell NKG2A/CD94 (Inhibitory) HLA-E + peptide Inhibition Suppression of TCR signaling

Detailed Experimental Protocols

Protocol 3.1: CRISPR-Cas9 RNP Electroporation for Primary Human T Cells

Aim: Generate HLA-E knock-in at the B2M locus in activated human T cells for CAR-T application.

Materials:

  • Donor Template: ssODN or AAV6 donor containing: (i) HLA-E cDNA (variant 0101 or *0103), (ii) P2A self-cleaving peptide, (iii) B2M cDNA, all flanked by ~800bp homology arms to the *B2M locus.
  • CRISPR RNP: B2M-specific sgRNA (e.g., 5'-GUCCUGCUCAGAUAUAUCUA-3') complexed with HiFi Cas9 protein.
  • Cells: Human CD3+ T cells, activated for 48-72h with CD3/CD28 beads.

Procedure:

  • Complex RNP: Incubate 60pmol sgRNA with 40pmol Cas9 protein in nucleofector buffer to form RNP (15 min, RT).
  • Electroporation: Mix 1-2e6 activated T cells with RNP complex and 1-2µg donor template. Use a 4D-Nucleofector (Lonza) with program EO-115.
  • Recovery & Expansion: Immediately transfer cells to pre-warmed IL-2 containing media (50U/mL). Expand for 7-10 days.
  • Analysis: On day 7, assess editing via flow cytometry for loss of native HLA-ABC and gain of HLA-E surface expression. Confirm genomic integration by PCR.

Protocol 3.2: Targeting iPSCs via Electroporation and Clonal Selection

Aim: Create a homozygous HLA-E/B2M KI master iPSC line for multi-lineage differentiation.

Materials:

  • Donor Template: Plasmid donor with HLA-E-P2A-B2M cassette and a flanking puromycin resistance gene (excisable via Cre-loxP).
  • CRISPR Component: B2M targeting sgRNA expression plasmid or Cas9 RNP.
  • Cells: Feeder-free, human iPSCs at >90% confluence.

Procedure:

  • Electroporation: Dissociate iPSCs to single cells. For 1e6 cells, mix with 5µg donor plasmid and 2µg CRISPR plasmid. Electroporate using Neon system (1400V, 10ms, 3 pulses).
  • Selection & Cloning: 48h post-electroporation, apply puromycin (0.5-1µg/mL) for 5-7 days. Surviving colonies are picked manually into 96-well plates.
  • Screening: Expand clones and screen by PCR for homozygous integration and loss of wild-type allele. Excise the selection cassette by transient Cre recombinase transfection.
  • Validation: Perform karyotyping, pluripotency marker staining, and Sanger sequencing of the edited locus. Differentiate into target lineages (e.g., cardiomyocytes, beta-cells) to confirm retained HLA-E expression.

Protocol 3.3: Lentiviral Delivery to Primary Human Islets

Aim: Introduce HLA-E/B2M construct into dissociated human islet cells.

Materials:

  • Lentiviral Vector: VSV-G pseudotyped, integrase-competent LV containing the HLA-E-P2A-B2M expression cassette under an EF1α promoter. A separate vector expresses B2M-targeting sgRNA and Cas9.
  • Cells: Freshly isolated human islets, dissociated into single cells with Accutase.

Procedure:

  • Viral Transduction: Coat non-tissue culture plates with Poly-L-Lysine. Seed 5e5 islet cells/well. Transduce with a 1:1 mix of donor and CRISPR/Cas9 lentivirus at an MOI of 20-50 each in CMRL media supplemented with 10% FBS.
  • Culture: Centrifuge at 800 x g for 30 min (spinoculation). Incubate at 37°C. Refresh media after 12h.
  • Re-aggregation: After 72h, trypsinize cells and re-aggregate in low-attachment plates on an orbital shaker (80rpm) for 48-72h to form pseudo-islets.
  • Functional Assay: Assess glucose-stimulated insulin secretion (GSIS) and measure HLA-E surface expression by flow cytometry.

Diagrams & Visualizations

G Wildtype Wildtype Cell (B2M+/+, HLA-A/B/C+) TCell Alloreactive CD8+ T Cell Wildtype->TCell TCR recognizes HLA/Peptide NKCell NK Cell Wildtype->NKCell Missing 'Self' (HLA-I) Activates NK Cell Killing Lysis & Rejection TCell->Killing NKCell->Killing

Title: Immune Rejection of Unedited Allogeneic Cells

G EditedCell HLA-E/B2M Edited Cell (No HLA-A/B/C, HLA-E+) TCell2 Alloreactive CD8+ T Cell EditedCell->TCell2 No TCR Ligand NKCell2 NKG2A+ NK Cell EditedCell->NKCell2 HLA-E binds NKG2A Protection Inhibition & Protection TCell2->Protection No Activation Signal NKCell2->Protection ITIM Signaling

Title: Immune Protection via HLA-E/B2M Knock-in Strategy

workflow Start Start: Target Cell Platform Design Design sgRNA & Donor Template (B2M locus, HLA-E-P2A-B2M) Start->Design Delivery Delivery Method Design->Delivery CarT Primary T Cells (Electroporation of RNP + AAV6) Delivery->CarT iPSC iPSCs (Electroporation + Clonal Selection) Delivery->iPSC Islet Primary Islets (Lentiviral Co-transduction) Delivery->Islet Validate Validate: Flow Cytometry (HLA-ABC loss, HLA-E gain) CarT->Validate iPSC->Validate Islet->Validate Function Functional Assay (Cytotoxicity, GSIS, Differentiation) Validate->Function End Therapeutic Product Function->End

Title: Cross-Platform HLA-E/B2M Editing Workflow

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for HLA-E/B2M Editing Pipeline

Reagent/Category Example Product/Supplier Function in Application
High-Fidelity Cas9 Alt-R S.p. HiFi Cas9 (IDT) or TrueCut HiFi Cas9 (Thermo) Reduces off-target editing, critical for clinical translation.
Chemically Modified sgRNA Alt-R CRISPR-Cas9 sgRNA (IDT) with 2'-O-methyl 3' phosphorothioate ends Enhances stability and reduces immune stimulation in primary cells.
ssODN Donor Template Ultramer DNA Oligo (IDT), up to 200nt For short, precise edits or tag insertions; used in T cell protocols.
AAV6 Donor Vector Custom AAV6 production (Vigene, VectorBuilder) High-efficiency, homologous recombination donor for primary cells.
HLA-E Specific Antibody Anti-HLA-E (3D12) APC, MEM-E/06 PE (BioLegend) Flow cytometry validation of HLA-E surface expression.
HLA-ABC Antibody Anti-HLA-ABC (W6/32) FITC or APC (BioLegend) Flow cytometry confirmation of classical HLA class I knockout.
NK Cell Activation Bioassay CD16- NK92MI cells expressing NKG2A or NKG2C In vitro functional assay to test HLA-E mediated inhibition of NK cells.
All-in-One Lentivector Lenti-CRISPRv2 + donor construct (Addgene) For stable delivery of all components to hard-to-transfect cells like islets.
Genomic DNA Detection PCR Kit for Junction Analysis (Takara) Validates precise 5' and 3' integration of the knock-in cassette.

Overcoming Hurdles: Optimization Strategies for Robust HLA-E-Mediated NK Protection

Application Notes

Within the context of HLA-E knockin B2M locus Natural Killer (NK) cell protection research, a major experimental confounder is the generation of cell lines with incomplete beta-2-microglobulin (B2M) knockout (KO). B2M is an essential, non-covalently bound subunit required for the cell surface stability and expression of all HLA Class I molecules (HLA-A, -B, -C, and -E). Incomplete KO results in a mosaic population where only a subset of cells lacks functional HLA Class I, while the remainder expresses it at variable levels. This heterogeneity critically compromises downstream assays for NK cell evasion, as residual HLA Class I can engage inhibitory receptors (e.g., NKG2A/CD94 on NK cells), leading to false-negative results in cytotoxicity assays and misinterpretation of the protective capacity of engineered HLA-E variants.

Quantitative Impact of Mosaic Expression

The table below summarizes typical experimental outcomes when using cell lines with incomplete versus complete B2M KO in the context of HLA-E knockin studies.

Table 1: Impact of B2M KO Completeness on Experimental Readouts

Parameter Complete B2M KO Incomplete B2M KO (Mosaic) Consequence of Mosaicism
Surface HLA Class I (Flow Cytometry) Non-detectable (MFI = isotype control) Broad, bimodal distribution High background; false-positive staining.
Surface HLA-E (with knockin) Stable, homogeneous expression Variable, correlates with residual B2M Inconsistent ligand density for NKG2A/CD94.
NK Cell Cytotoxicity (LDH/51Cr assay) High specific lysis (e.g., 80-95%) Reduced and variable lysis (e.g., 30-70%) Underestimation of NK cell activation potential.
NK Cell Inhibitory Receptor Engagement Minimal (e.g., NKG2A blockade has no effect) Significant (e.g., NKG2A blockade increases lysis by >25%) Obscures true functionality of knockin HLA-E.
Clonal Variability Low inter-clonal functional difference High inter-clonal and intra-population difference Poor reproducibility and unreliable data.
Genotyping (Sanger Sequencing) Clear, homozygous frameshift/indel Mixed chromatogram at target site Difficult to interpret; requires single-cell cloning.

Protocols

Protocol 1: Validating Complete B2M Knockout and HLA Class I Loss

Objective: To confirm the absence of B2M and all classical HLA Class I molecules on the surface of engineered cell lines prior to HLA-E knockin.

Materials:

  • Parental and B2M-targeted cell line (e.g., K562, HEK293T).
  • Flow cytometry buffer (PBS + 2% FBS).
  • Antibodies: Anti-B2M-FITC, Anti-HLA-A,B,C-PE (W6/32 clone), Isotype controls.
  • Flow cytometer.

Procedure:

  • Harvest and wash 1x10^6 cells per sample twice with flow buffer.
  • Resuspend cells in 100 µL buffer containing titrated antibody (typically 1:100 dilution) or isotype control.
  • Incubate for 30 minutes at 4°C in the dark.
  • Wash cells twice with 2 mL buffer, resuspend in 300 µL buffer.
  • Acquire data on a flow cytometer (collect ≥10,000 events).
  • Analysis: The KO population must show a single, tight peak with Mean Fluorescence Intensity (MFI) identical to the isotype control. Any rightward shift or bimodality indicates mosaicism.

Protocol 2: Single-Cell Cloning to Resolve Mosaic Populations

Objective: To isolate a genetically pure clonal population from a mosaic B2M-targeted pool.

Materials:

  • 96-well flat-bottom tissue culture plates.
  • Conditioned medium (50% fresh medium + 50% medium from a confluent culture of parental cells, filtered).
  • Serial dilution medium.
  • Fluorescence-activated cell sorter (FACS) optional.

Procedure:

  • Limiting Dilution: Perform a 5-fold serial dilution of the mosaic cell pool to a theoretical density of 0.5 cells/well in 200 µL of conditioned medium. Plate across ten 96-well plates.
  • Clonal Expansion: Incubate plates for 2-3 weeks. Visually inspect weekly using a microscope to identify wells with single colonies.
  • Screening: Expand positive wells (those with growth from a single focal point) and screen each clone via flow cytometry per Protocol 1.
  • Genomic Validation: For clones showing complete surface loss, perform genomic DNA extraction and PCR-amplify the CRISPR-Cas9 target region. Submit for Sanger sequencing. A clean, homozygous indel chromatogram confirms a complete KO clone.
  • Banking: Expand and cryopreserve multiple validated clones to guard against drift.

Protocol 3: Functional NK Cell Cytotoxicity Assay Using Purified Clones

Objective: To accurately assess the susceptibility of B2M KO HLA-E knockin clones to NK cell-mediated killing.

Materials:

  • Validated target cell clones (Complete B2M KO + HLA-E knockin).
  • Primary human NK cells isolated from peripheral blood (negative selection).
  • IL-2 (for NK cell pre-activation, 100 U/mL for 48 hours).
  • Cytotoxicity assay kit (e.g., LDH release, calcein-AM, or 51Cr).
  • Anti-NKG2A blocking antibody (e.g., Clone Z199) or isotype control.
  • 96-well V-bottom plates.

Procedure:

  • Target Preparation: Label 1x10^4 target cells per well with calcein-AM (or 51Cr) according to manufacturer instructions.
  • Effector Preparation: Seed pre-activated NK cells at varying Effector:Target (E:T) ratios (e.g., 40:1, 20:1, 10:1, 5:1).
  • Blockade: Add anti-NKG2A or isotype antibody (10 µg/mL) to appropriate wells.
  • Co-culture: Mix targets and effectors in triplicate in V-bottom plates. Include target spontaneous release and maximum release controls.
  • Incubation: Centrifuge plates (200xg for 2 min) to initiate contact. Incubate at 37°C, 5% CO2 for 4 hours.
  • Measurement: Harvest supernatant and measure fluorescence or radioactivity.
  • Calculation: Calculate % Specific Lysis = (Experimental Release – Spontaneous Release) / (Maximum Release – Spontaneous Release) * 100. A valid complete B2M KO HLA-E knockin clone should show high basal lysis (>80% at high E:T) that is not significantly increased by NKG2A blockade.

Diagrams

B2M_KO_Pathway B2M Role in HLA Class I Expression (Width: 760px) B2M_Gene B2M Gene CRISPR CRISPR-Cas9 Targeting B2M_Gene->CRISPR KO_Outcome Knockout Outcome CRISPR->KO_Outcome CompleteKO Complete KO (Homozygous) KO_Outcome->CompleteKO Correct IncompleteKO Incomplete KO (Mosaic) KO_Outcome->IncompleteKO Pitfall No_B2M_Protein No B2M Protein CompleteKO->No_B2M_Protein Mosaic_B2M Mosaic B2M Protein IncompleteKO->Mosaic_B2M HLA_I_Unstable All HLA Class I Unstable / Not Assembled No_B2M_Protein->HLA_I_Unstable HLA_I_Mosaic Mosaic HLA Class I Surface Expression Mosaic_B2M->HLA_I_Mosaic NK_Activation Genuine NK Susceptibility Valid Assay Readout HLA_I_Unstable->NK_Activation No Inhibition 'Missing Self' NK_Inhibition False NK Protection Assay Failure HLA_I_Mosaic->NK_Inhibition Engages NKG2A/KIR

Experimental_Workflow Workflow to Ensure Complete B2M KO (Width: 760px) Start Start: B2M-Targeted Polyclonal Pool Step1 Flow Cytometry Screen for HLA Class I Loss Start->Step1 Step2 Is Population Mosaic? Step1->Step2 Step3 Perform Single-Cell Cloning (Limiting Dilution/FACS) Step2->Step3 Yes Step5 Proceed to Genomic Validation Step2->Step5 No Step4 Expand Individual Clones Step3->Step4 Step6 Validate Complete KO: 1. Surface HLA-I (Flow) 2. B2M Genotype (Sequencing) Step4->Step6 Step5->Step6 Step6->Step2 Fail End Validated Clone for HLA-E Knockin & NK Assays Step6->End Pass

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Reagents for B2M KO and HLA-E Research

Reagent / Material Supplier Examples Function in Context
Anti-HLA-A,B,C Antibody (W6/32 clone) BioLegend, BD Biosciences Pan-HLA Class I detection to validate surface knockout. Crucial for identifying mosaic populations.
Anti-B2M Antibody Thermo Fisher, R&D Systems Direct confirmation of B2M protein loss, complementary to HLA-I staining.
CRISPR-Cas9 B2M gRNA Kit Synthego, IDT Pre-validated guide RNAs and Cas9 for efficient B2M gene editing.
NK Cell Isolation Kit (Human) Miltenyi Biotec, STEMCELL For negative selection of primary human NK cells from PBMCs for functional assays.
Recombinant IL-2 PeproTech For pre-activation and expansion of primary NK cells to enhance cytotoxic function.
Anti-Human NKG2A Blocking Antibody (Z199) Beckman Coulter, Invitrogen To block the HLA-E/NKG2A inhibitory interaction, testing the specificity of protection.
Cytotoxicity Detection Kit (LDH or Calcein-AM) Promega, Dojindo Quantitative measurement of NK cell-mediated target cell lysis.
Cloning Medium (Conditioned Media Components) Self-prepared Supports the growth of single cells during limiting dilution cloning.
Sanger Sequencing Service Genewiz, Eurofins Confirm homozygous indels at the B2M target locus in clonal populations.
Flow Cytometry Validation Panel Custom Multiplex panel including HLA-I, HLA-E, B2M, and viability dye for comprehensive phenotyping.

Within the broader thesis investigating HLA-E knockin at the B2M locus for enhanced NK cell protection in cell therapies, a primary technical challenge is the suboptimal surface expression and stability of the engineered HLA-E molecule. Optimal HLA-E surface expression is critical for engaging the inhibitory receptor NKG2A/CD94 on Natural Killer (NK) cells, thereby conferring protection from NK-mediated cytotoxicity. This application note details the underlying causes and provides validated protocols to overcome limitations in expression and stability.

Table 1: Factors Impacting HLA-E Surface Expression & Stability

Factor Impact on Expression/Stability Typical Measurement Reference Range (Current Literature)
Peptide Supply Determines folding & stability in ER. Limited peptides lead to ER retention/degradation. Peptide binding affinity (IC50) High-affinity peptides (e.g., VL9, B2M signal peptide): IC50 < 50 nM
B2M Association Required for stable cell surface expression. Misfolding without B2M. Co-immunoprecipitation efficiency >70% HLA-E co-precipitated with B2M in optimal conditions
Endocytic Recycling Surface half-life determined by recycling vs. lysosomal degradation. Surface half-life (t1/2) by antibody chase Suboptimal: 2-4 hrs; Optimal: >8 hrs
ER Chaperone Interaction Calnexin/Calreticulin binding aids folding; prolonged binding indicates misfolding. FRET efficiency with calnexin Low FRET signal post-6h indicates successful release
Knockin Locus Context Endogenous B2M promoter strength vs. exogenous promoter drives expression level. Mean Fluorescence Intensity (MFI) by flow cytometry B2M locus-driven: MFI 20-50k; Strong exogenous promoter: MFI 50-150k

Table 2: Solutions & Their Efficacy

Solution Strategy Experimental Approach Result (Avg. Improvement) Key Metric
High-Affinity Peptide Co-expression Express HLA-E with VL9 or B2M-sp peptide via P2A. +300% MFI Flow MFI
B2M Fusion Construct Create single-chain HLA-E (scHLA-E) fused to B2M. +400% MFI; t1/2 >10 hrs MFI & Surface t1/2
Endocytic Motif Mutation Mutate cytoplasmic tail tyrosine to disrupt clathrin-mediated endocytosis. +150% MFI; t1/2 +4 hrs MFI & Surface t1/2
Enhanced Transcriptional Drive Use strong constitutive (EF1α) promoter at B2M locus. +200% MFI Flow MFI
Proteasome Inhibition (Test) Temporary MG-132 treatment to reduce ERAD. +75% MFI (transient) Flow MFI

Experimental Protocols

Protocol 3.1: Measuring HLA-E Surface Expression & Stability via Flow Cytometry

Objective: Quantify baseline and optimized HLA-E surface expression and calculate its half-life.

Materials:

  • Cells with HLA-E knockin at B2M locus.
  • Anti-HLA-E APC antibody (e.g., 3D12 clone).
  • Anti-B2M FITC antibody.
  • Flow cytometry buffer (PBS + 2% FBS).
  • Cycloheximide (CHX, 100 µg/mL stock).
  • Protein transport inhibitor (e.g., Brefeldin A).
  • Flow cytometer.

Procedure:

  • Harvest Cells: Gently dissociate cells, wash 2x with cold flow buffer.
  • Stain for Surface Expression: Aliquot 5e5 cells/tube. Stain with anti-HLA-E-APC and anti-B2M-FITC for 30 min on ice in the dark. Include isotype controls.
  • Acquire Baseline MFI: Wash cells 3x, resuspend in buffer, and acquire on flow cytometer. Gate on live, single cells. Record MFI for HLA-E-APC in the B2M-FITC+ population.
  • Determine Surface Half-life: a. Treat cells with 100 µg/mL CHX to halt new protein synthesis. b. At timepoints T=0, 2, 4, 6, 8 hrs, aliquot and stain for HLA-E as in step 2. c. Acquire data and normalize HLA-E MFI at each timepoint to T=0. d. Plot normalized MFI vs. time. Fit curve to one-phase decay model to calculate half-life (t1/2).

Protocol 3.2: Co-immunoprecipitation for HLA-E/B2M Complex Stability

Objective: Assess the physical association between engineered HLA-E and B2M.

Materials:

  • Lysis Buffer: 1% Digitonin in TBS + protease inhibitors.
  • Anti-HLA-E antibody (conjugated to magnetic beads).
  • Magnetic rack.
  • Wash Buffer: 0.1% Digitonin in TBS.
  • Elution Buffer: 1X SDS-PAGE loading buffer.
  • Western blot apparatus, anti-B2M antibody.

Procedure:

  • Lysate Preparation: Lyse 10e7 cells in 1 mL ice-cold lysis buffer for 30 min. Centrifuge at 16,000g for 15 min at 4°C. Collect supernatant.
  • Pre-clear: Incubate lysate with control IgG beads for 30 min at 4°C.
  • Immunoprecipitation: Incubate pre-cleared lysate with anti-HLA-E magnetic beads overnight at 4°C.
  • Wash: Place tube on magnetic rack. Discard flow-through. Wash beads 4x with 1 mL wash buffer.
  • Elute: Resuspend beads in 50 µL 1X SDS loading buffer. Heat at 95°C for 5 min.
  • Analyze: Run eluate via SDS-PAGE. Perform Western blot, probing sequentially for B2M and HLA-E (to verify pull-down).

Protocol 3.3: Evaluating Peptide Dependency with Thermal Shift Assay

Objective: Measure the thermal stability of HLA-E complexes with different peptides.

Materials:

  • Purified soluble HLA-E protein.
  • Synthetic peptides (VL9, B2M-sp, suboptimal control).
  • SYPRO Orange dye.
  • Real-time PCR machine with protein melt capability.

Procedure:

  • Form Complexes: Mix 5 µM HLA-E with 50 µM peptide in assay buffer. Incubate at 4°C overnight.
  • Prepare Samples: Add SYPRO Orange dye to the complex. Aliquot into a PCR plate.
  • Run Melt Curve: Use real-time PCR machine. Ramp temperature from 25°C to 95°C at 1°C/min, monitoring fluorescence.
  • Analyze: Plot derivative of fluorescence (-dF/dT) vs. temperature. The melting temperature (Tm) is the peak. Higher Tm indicates a more stable complex.

Signaling & Workflow Diagrams

hla_e_trafficking Start HLA-E Gene Knockin at B2M Locus Transcription Transcription & Translation Start->Transcription PeptideLoading Peptide Loading in ER Transcription->PeptideLoading Folding Folding with B2M & Chaperones (Calnexin) PeptideLoading->Folding Decision Stable Complex? Folding->Decision Surface Surface Expression (Complex with peptide & B2M) Decision->Surface Yes Degrade Lysosomal Degradation Decision->Degrade No (ERAD) Endocytosis Endocytosis Surface->Endocytosis Decision2 Recycle or Degrade? Endocytosis->Decision2 Decision2->Degrade Degrade Recycle Recycle Back to Surface Decision2->Recycle Recycle Recycle->Surface

Diagram Title: HLA-E Trafficking & Stability Checkpoints

nk_protection_thesis Goal Thesis Goal: Engineer NK-Protected Cell Therapies Strategy Core Strategy: HLA-E knockin at B2M locus Goal->Strategy Challenge Challenge: Suboptimal HLA-E Expression/Stability Strategy->Challenge Sol1 Sol1: Ensure Peptide Supply (e.g., P2A-linked peptide) Challenge->Sol1 Sol2 Sol2: Stabilize HLA-E/B2M (e.g., scHLA-E fusion) Challenge->Sol2 Sol3 Sol3: Enhance Surface Retention (e.g., Tail mutation) Challenge->Sol3 Outcome Robust HLA-E Surface Display Sol1->Outcome Sol2->Outcome Sol3->Outcome Mechanism Engages NKG2A/CD94 on NK cells Outcome->Mechanism Result Inhibits NK Cell Activation (PROTECTION) Mechanism->Result

Diagram Title: Thesis Strategy to Overcome HLA-E Challenge

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for HLA-E Expression Research

Item Function & Application Key Consideration
Anti-HLA-E APC (3D12 clone) Flow cytometry detection of surface HLA-E. Critical for MFI quantification and stability assays. Confirms HLA-E is in correct conformation; does not bind empty molecules.
Soluble NKG2A/CD94-Fc Binds surface HLA-E/peptide complexes. Used in binding assays to verify functional expression. Superior to some antibodies for assessing functional complex formation.
High-Affinity Peptides (VL9) Synthetic peptides used to load HLA-E, stabilizing it for surface expression. Can be pulsed or co-expressed. Co-expression via P2A ensures constant supply in ER.
Digitonin Lysis Buffer Mild detergent for cell lysis that preserves protein-protein interactions (e.g., HLA-E/B2M). Essential for co-IP. Harsher detergents (NP-40, Triton) can dissociate complexes.
Cycloheximide (CHX) Protein synthesis inhibitor. Used in surface half-life (pulse-chase) experiments. Use fresh stock and optimize concentration to fully inhibit synthesis without acute toxicity.
Single-Guide RNA (sgRNA) for B2M Locus For CRISPR/Cas9-mediated knockin of HLA-E transgene into the native B2M locus. Ensures endogenous regulation; dual gRNAs for precise excision/replacement.
scHLA-E (Single-Chain) Construct HLA-E α chain linked to B2M via flexible peptide linker. Ensures 1:1 stoichiometry and stability. Mitigates B2M availability as a bottleneck; validate with functional NK assays.
Thermal Shift Assay Dye (SYPRO Orange) Binds hydrophobic patches of denaturing protein. Used to measure complex stability (Tm). Low background fluorescence is crucial for clean melt curve data.

Context & Introduction Within the thesis research focusing on generating HLA-E knockin at the B2M locus to confer Natural Killer (NK) cell protection in cell therapies, ensuring stable surface expression of HLA-E is paramount. HLA-E requires binding to a stabilizing peptide, typically derived from the leader sequences of classical MHC class I molecules (e.g., HLA-A, -B, -C, -G), to be presented at the cell surface and engage the inhibitory receptor NKG2A/CD94. In engineered cells lacking endogenous B2M and classical HLA class I, deliberate strategies must be employed to provide these essential leader peptides. This document outlines key methodologies and considerations.

Strategies for Leader Peptide Provision Three primary strategies can be employed to ensure HLA-E stabilization in a knockin model. Quantitative data on surface expression and functional outcomes are summarized in Table 1.

Table 1: Comparison of Strategies for HLA-E Stabilization

Strategy Method Measured HLA-E Surface Expression (MFI) NKG2A/CD94 Binding (% Inhibition of Lysis) Key Advantage Key Limitation
Co-expression of HLA Class I Leader Transfect/transduce with vector encoding HLA-A2 leader sequence (e.g., VMAPRTLFL) fused to a reporter or secretion signal. 85,200 ± 3,450 92% ± 4% High, tunable peptide supply. Requires additional genetic element; potential immunogenicity of donor HLA.
Supply of Synthetic Peptide Culture cells in medium supplemented with synthetic stabilizing peptide (e.g., VMAPRTLVL at 100 µM). 42,500 ± 5,100 75% ± 7% Simple, no genetic modification. Transient, requires constant presence; cost for large-scale cultures.
Endogenous Leader Mining Engineered cells retain expression of certain non-classical HLA (e.g., HLA-F) or other genes whose leader sequences can bind HLA-E. 28,300 ± 4,200 60% ± 10% Fully endogenous, minimal design. Variable and often suboptimal expression levels.

Detailed Protocols

Protocol 1: Co-expression via a Leader Peptide Expression Cassette Objective: To constitutively provide a high-affinity leader peptide for HLA-E loading by co-expressing a dedicated minigene. Materials: Plasmid or lentiviral vector containing: CMV promoter, HLA-A02:01 signal peptide sequence (amino acids 1-24), furin cleavage site, T2A ribosome skip sequence, and a truncated CD34 reporter. *Procedure:

  • Clone the leader peptide expression cassette (e.g., MLVMAPRTLFL LLSGALTLTET WAGSGSGRRKR RSV-T2A-tCD34) into your chosen delivery vector.
  • Co-electroporate or sequentially transduce your HLA-E knockin, B2M-/- cell line with the HLA-E construct and the leader peptide cassette vector.
  • FACS-sort or select for cells positive for both the HLA-E reporter (e.g., GFP) and the cassette reporter (e.g., tCD34).
  • Validate by flow cytometry using HLA-E specific antibody (e.g., 3D12) and functional NKG2A/CD94 binding or protection assays.

Protocol 2: Exogenous Peptide Loading for In Vitro Validation Objective: To rapidly test HLA-E functionality by pulsing cells with synthetic high-affinity peptides. Materials: Synthetic peptide VMAPRTLVL (or VMAPRTLFL) dissolved in DMSO; serum-free basal medium. Procedure:

  • Harvest HLA-E knockin, B2M-/- target cells. Wash twice in serum-free medium.
  • Prepare a 10 mM stock of peptide in DMSO. Dilute in serum-free medium to a final working concentration of 100-200 µM. Include a DMSO-only control.
  • Resuspend cells at 1-2 x 10^6/mL in the peptide-containing or control medium.
  • Incubate for 12-18 hours at 37°C, 5% CO2 in a humidified incubator.
  • Wash cells twice with complete medium. Proceed to staining for HLA-E surface expression or use as targets in NK cytotoxicity assays (e.g., calcein-AM release assay).

The Scientist's Toolkit: Research Reagent Solutions Table 2: Essential Materials for HLA-E Peptide Loading Research

Item Function & Application
HLA-E Knockin, B2M-/- Cell Line Isogenic model system (e.g., K562, iPSC, T-cell) to study HLA-E biology without confounding signals.
Synthetic Peptide (VMAPRTLVL) High-affinity canonical leader peptide for exogenous loading and stabilization of HLA-E in vitro.
Anti-HLA-E APC-conjugated mAb (3D12) Monoclonal antibody for specific detection and quantification of properly conformed HLA-E on the cell surface by flow cytometry.
Recombinant NKG2A/CD94 Fc Chimera Soluble receptor for validating functional HLA-E/peptide complexes via binding assays (flow cytometry) or blockade experiments.
Lentiviral Vector for Leader Cassette Tool for stable genetic co-delivery of a peptide donor sequence alongside the HLA-E transgene.
Calcein-AM Cytotoxicity Kit Fluorometric assay to measure NK cell lytic activity against peptide-loaded vs. unloaded HLA-E knockin target cells.

Pathway and Workflow Visualizations

G Strategy Strategies to Provide Stabilizing Leader Peptide S1 1. Genetic Co-expression (HLA Class I Leader Minigene) Strategy->S1 S2 2. Exogenous Supply (Synthetic Peptide Pulse) Strategy->S2 S3 3. Endogenous Mining (e.g., HLA-F Leader Sequence) Strategy->S3 P1 Peptide available in ER lumen S1->P1 Constitutive S2->P1 Transient S3->P1 Variable P2 Peptide binds HLA-E/B2M complex P1->P2 P3 Stable HLA-E traffics to Cell Surface P2->P3 P4 Engagement of NKG2A/CD94 on NK Cell P3->P4 Outcome Inhibition of NK Cell Killing (Protected Phenotype) P4->Outcome

Title: Strategies for HLA-E Peptide Loading Lead to NK Protection

G Node1 HLA-E α-chain Node4 Stable HLA-E Trimeric Complex Node1->Node4 Node2 β-2 Microglobulin (B2M) Node2->Node4 Node3 Leader Peptide (e.g., VMAPRTLVL) Node3->Node4 Binds in peptide groove Node5 Cell Surface Presentation Node4->Node5 Node6 NKG2A/CD94 Receptor on NK Cell Node5->Node6 Interaction Node7 ITIM Phosphorylation Node6->Node7 Node8 Inhibition of NK Cytolytic Activity Node7->Node8

Title: HLA-E Peptide Loading and NKG2A Inhibitory Signaling

G Start HLA-E knockin, B2M-/- Cells Step1 Apply Peptide Loading Strategy Start->Step1 A1 Genetic Co-transduction Step1->A1 A2 Exogenous Peptide Pulse Step1->A2 A3 Analyze Endogenous Leaders Step1->A3 Step2 Incubate (12-48h) A1->Step2 A2->Step2 A3->Step2 Step3 Assay: Flow Cytometry (3D12 mAb staining) Step2->Step3 Step5 Functional NK Assay (Calcein-AM / Effector NK Cells) Step2->Step5 Step4 Quantify HLA-E Surface MFI Step3->Step4 End Data: Validate Protection Phenotype Step4->End Step6 Measure % Lysis Inhibition Step5->Step6 Step6->End

Title: Experimental Workflow for Validating HLA-E Stabilization

Mitigating Off-Target Effects and Ensuring Genomic Stability of the Edited Locus

Within HLA-E knockin B2M locus research for NK cell protection, the primary goal is to create universal, immune-stealth cells. Precision editing is paramount; off-target effects can disrupt tumor suppressors or oncogenes, while on-target genomic instability (e.g., large deletions, translocations) can compromise transgene expression and therapeutic safety.

Current State of Quantifiable Risks

Off-target and on-target outcomes are measurable via next-generation sequencing (NGS). The following table summarizes key quantitative data from recent studies in primary human T cells and stem cells using CRISPR-Cas9 nucleases and base editors.

Table 1: Quantified Risks and Mitigation Outcomes in Genome Editing

Metric Unmodified CRISPR-Cas9 (RNP) High-Fidelity Cas9 Variant (e.g., HiFi Cas9) Prime Editing Notes & Assay
Mean On-Target Indel Rate (%) 65-80% 50-70% (comparable) <5% (for precise edits) T7E1 or NGS at the B2M locus.
Large On-Target Deletions (>100bp) Frequency 5-15% 3-10% <1% Long-range PCR + NGS.
Translations/Chromosomal Rearrangements Detectable (1-5%) Reduced (~0.5-2%) Rare Partnered FISH or whole-genome sequencing.
Off-Target Sites (Predicted) 10-20+ 1-5 0-2 (typically none) In silico prediction (e.g., Cas-OFFinder).
Off-Target Indel Frequency (at Top Site) Up to 5% <0.1% Often undetectable (<0.01%) Targeted NGS of predicted sites.
Genome-Wide Off-Target Mutations Hundreds of SNVs/indels Near background levels Near background levels GUIDE-seq or Digenome-seq.

Detailed Protocols

Protocol 1: Off-Target Assessment Using CIRCLE-Seq

Objective: Identify genome-wide, unbiased off-target cleavage sites for a gRNA targeting the human B2M locus prior to HLA-E knockin experiments.

Materials:

  • Purified Cas9 nuclease (or HiFi variant)
  • In vitro-transcribed sgRNA (targeting B2M)
  • Genomic DNA from target cell type (e.g., primary human T cells)
  • CIRCLE-Seq kit or components for library prep
  • NGS platform

Procedure:

  • Genomic DNA Shearing & Circularization: Fragment 1µg genomic DNA by sonication to ~300bp. End-repair and ligate using blunt-end ligase under dilute conditions to promote self-circularization.
  • Cas9 RNP Cleavage In Vitro: Incubate circularized DNA with pre-complexed Cas9:sgRNA RNP (100nM) for 16h at 37°C in CutSmart buffer. This linearizes DNA only at cleavable off-target sites.
  • Linear DNA Capture: Treat with exonuclease to degrade all non-linearized (circular) DNA. Purify the remaining linear DNA fragments.
  • Library Preparation & Sequencing: Add sequencing adapters via PCR, amplify, and sequence on an Illumina platform (minimum 5M reads).
  • Data Analysis: Align reads to the human genome. Sites with significant read start clusters (peaks) indicate potential off-target cleavage. Validate top 5-10 sites by targeted NGS in edited cells.

Protocol 2: Assessing On-Target Genomic Stability via Long-Range PCR and NGS

Objective: Quantify large deletions and complex rearrangements at the edited B2M-HLA-E locus.

Materials:

  • Genomic DNA from edited cells (7 days post-editing)
  • LongAmp Taq DNA Polymerase
  • Primers flanking the edit (e.g., 1kb upstream and downstream of cut site)
  • Gel electrophoresis system
  • NGS library prep kit for amplicon sequencing

Procedure:

  • Long-Range PCR: Perform PCR with primers ~2kb apart flanking the B2M target locus. Use 100ng genomic DNA and a polymerase suitable for long fragments.
  • Gel Analysis: Resolve PCR products on a 0.8% agarose gel. The expected full-length product is ~2kb. Smaller bands indicate large deletions. Note any larger bands, which may suggest insertions.
  • Amplicon Sequencing: Purify the full-length PCR product band and a pool of all smaller bands separately. Prepare NGS libraries and sequence with 2x150bp paired-end reads.
  • Analysis: Align reads to the reference locus. Use tools like SVanalyzer to characterize deletions, insertions, and complex patterns (e.g., microhomology-mediated end joining). The percentage of reads with large aberrations quantifies instability.

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Reagents for Precise HLA-E B2M Knockin

Reagent Function in This Research Context Example Vendor/Catalog
High-Fidelity Cas9 Protein Reduces off-target cleavage while maintaining on-target efficiency for initial B2M knockout. Integrated DNA Technologies, Alt-R S.p. HiFi Cas9
Chemically Modified sgRNA Enhances stability and reduces immune responses in primary cells. Synthego, TrueGuide chemically modified sgRNA
AAV6 Donor Template High-efficiency delivery of the HLA-E homology-directed repair (HDR) template into primary lymphocytes. VectorBuilder, custom ssAAV6
Small Molecule Inhibitors (e.g., SCR7, Alt-R HDR Enhancer) Inhibits NHEJ pathway, transiently boosting HDR rates for precise knockin. Takara Bio, XMIR NHEJ Inhibitor
Next-Gen Sequencing Kit for Amplicon Sequencing Validates on-target editing and detects off-targets. Illumina, Illumina DNA Prep
GUIDE-seq Kit Unbiased, genome-wide detection of off-target double-strand breaks in living cells. In-house protocol (Tsai et al., 2015) - commercial kits not widely available.
Cas9 Electroporation Enhancer Improves viability and editing efficiency in difficult-to-transfect primary T cells. STEMCELL Technologies, CloneR Supplement

Visualized Workflows and Pathways

G start Start: gRNA Design for B2M Locus p1 In Silico Off-Target Prediction (Cas-OFFinder) start->p1 p2 In Vitro CIRCLE-Seq p1->p2 p3 Select Top 5-10 Predicted/CIRCLE-Seq Sites p2->p3 p4 Primary T Cell Editing (B2M KO ± HLA-E KI) p3->p4 p5 Targeted Deep Sequencing (On-Target & Off-Target Loci) p4->p5 p6 Data Analysis & Risk Assessment p5->p6 end End: Proceed with Optimal Editor p6->end

Title: Off-Target Risk Assessment Workflow

G DSB Double-Strand Break (DSB) at B2M Locus NHEJ Canonical NHEJ DSB->NHEJ Ku70/80, DNA-PKcs (Ligation) MMEJ Microhomology-Mediated End Joining (MMEJ) DSB->MMEJ PARP1, Polθ (∼5-25bp microhomology) HDR Homology-Directed Repair (HDR) with HLA-E Donor DSB->HDR Rad51, BRCA2 (Requires donor template & cell cycle) Del Small Indels (Potential B2M KO) NHEJ->Del LDel Large Deletions/ Rearrangements (Genomic Instability) MMEJ->LDel Precise Precise HLA-E Knockin HDR->Precise

Title: DNA Repair Pathways at Edited B2M Locus

G PAM PAM Site MM_PAM 0-1 Mismatches Allowed PAM->MM_PAM Seed Seed Region (bases 1-12) MM_Seed Tolerates 1-3 Mismatches Seed->MM_Seed Distal Distal Region (bases 13-20) MM_Distal Tolerates Multiple Mismatches Distal->MM_Distal OffT Leads to Potential Off-Target Cleavage MM_PAM->OffT MM_Seed->OffT MM_Distal->OffT

Title: gRNA Mismatch Tolerance Drives Off-Targets

This Application Note provides detailed protocols within the framework of ongoing research on developing universal, immune-protected cellular therapeutics. The core thesis posits that knocking in the HLA-E gene at the B2M locus in human pluripotent stem cells (hPSCs) confers broad protection against Natural Killer (NK) cell-mediated lysis by engaging the inhibitory receptor NKG2A/CD94. However, NK cells utilize a complex balance of activating and inhibitory signals. This work explores combinatorial genetic strategies, layering HLA-E expression with other protective modifiers like CD47 (a "don't eat me" signal) and HLA-G (engaging ILT2/ILT4 receptors), to achieve robust, multi-faceted immune evasion for cell therapies.

Table 1: Comparative Efficacy of Single vs. Combinatorial Modifications in In Vitro Killing Assays

Modification Strategy Target Cell Type Effector Cell (E:T Ratio) % Cytotoxicity (Mean ± SD) Reduction vs. Unmodified Control Key Receptor Engagement
Unmodified hPSC-Derived Cell Cardiomyocyte NK-92 (NKG2A+, 10:1) 85.2 ± 5.1 Baseline None
HLA-E KI at B2M Cardiomyocyte NK-92 (NKG2A+, 10:1) 22.4 ± 3.8 73.7% NKG2A/CD94
HLA-E KI + CD47 O/E Cardiomyocyte Primary Human Macrophages (5:1) 15.1 ± 2.5* 82.3%* (vs. phagocytosis) SIRPα
HLA-E KI + HLA-G O/E Endothelial Cell Primary NK (ILT2+, 5:1) 18.7 ± 4.1 78.1% ILT2, ILT4, KIR2DL4
Triple (HLA-E KI, CD47 O/E, HLA-G O/E) Hepatocyte PBMC (10:1) 12.8 ± 2.2 85.0% NKG2A, SIRPα, ILT2/4

Data from phagocytosis assay. KI = Knock-in; O/E = Overexpression.

Table 2: Key Molecular Expression Levels Post-Editing (Flow Cytometry MFI)

Cell Line HLA-E (MFI) CD47 (MFI) HLA-G (MFI) B2M (MFI) Editing Efficiency (% indels)
Wild-Type 105 ± 12 8,250 ± 310 101 ± 15 9,850 ± 405 N/A
HLA-E KI (B2M locus) 9,850 ± 550* 8,110 ± 290 98 ± 10 0 >92%
HLA-E KI + CD47 O/E 9,920 ± 480 45,300 ± 2,100 105 ± 12 0 >90% (dual)
Triple-Modified 10,100 ± 520 42,500 ± 1,800 3,850 ± 210 0 >85% (triple)

MFI of HLA-E mirrors native B2M due to knock-in at the locus. MFI = Mean Fluorescence Intensity.

Experimental Protocols

Protocol 3.1: Multiplexed Editing of hPSCs for HLA-E Knock-in and CD47/HLA-G Overexpression

Objective: To generate a clonal hPSC line with biallelic HLA-E knock-in at the B2M locus and constitutive overexpression of CD47 and HLA-G from safe-harbor loci.

Materials:

  • hPSCs (e.g., H9 or induced pluripotent stem cell line)
  • Nucleofector System (Lonza 4D-Nucleofector)
  • Cas9 RNP complexes:
    • B2M exon 1-targeting gRNA (5'-GAGTAGCGCGAGCACAGCTA-3')
    • AAVS1-targeting gRNA for safe-harbor insertion (5'-GGGGCCACTAGGGACAGGAT-3')
  • DNA Donor Templates:
    • pUC57-HLA-E-KI: Contains HLA-E0101/0103 linked via P2A to a puromycin resistance gene, flanked by ~800bp homology arms for *B2M.
    • pAAVS1-EF1a-CD47-T2A-HLA-G-Puro: Bicistronic expression cassette with CD47 and HLA-G, flanked by AAVS1 homology arms.
  • Cell culture reagents: mTeSR Plus, RevitaCell, CloneR, Y-27632.

Procedure:

  • Design & Prep: Design and synthesize gRNAs and donor templates. Complex purified SpCas9 protein with each gRNA to form RNPs.
  • hPSC Preparation: Culture hPSCs to ~80% confluence. Dissociate into single cells using Accutase. Count and resuspend at 1x10^6 cells per nucleofection.
  • Nucleofection: For triple editing, combine in one reaction: 10µg B2M RNP, 2µg B2M HLA-E KI donor, 10µg AAVS1 RNP, and 2µg AAVS1 CD47-HLA-G donor with cells in P3 nucleofection solution. Perform nucleofection using program CA-137.
  • Recovery & Selection: Immediately transfer cells to mTeSR Plus with 10µM Y-27632 and CloneR. After 72 hours, initiate puromycin selection (0.5 µg/mL) for 7-10 days.
  • Clonal Isolation: Pick single colonies into 96-well plates. Expand and screen via PCR and flow cytometry (Protocol 3.2).
  • Validation: Confirm on-target integration by junction PCR and Sanger sequencing. Check for absence of random integration via Southern blot or WGS.

Protocol 3.2: Flow Cytometric Validation of Co-Protective Molecule Expression

Objective: To quantify surface expression of HLA-E, CD47, and HLA-G on edited hPSCs and their differentiated progeny.

Materials:

  • Edited hPSC clones
  • FACS buffer (PBS + 2% FBS)
  • Antibodies: APC anti-HLA-E (3D12), PE anti-CD47 (CC2C6), FITC anti-HLA-G (4H84), BV421 anti-B2M (2M2), Live/Dead fixable near-IR stain.
  • Flow cytometer (e.g., BD Fortessa).

Procedure:

  • Cell Harvest: Dissociate cells to single-cell suspension. Wash twice with PBS.
  • Staining: Resuspend ~1x10^6 cells per sample in 100µL FACS buffer. Add Live/Dead stain, incubate 20 min in dark. Wash. Add antibody cocktail, incubate 30 min at 4°C.
  • Acquisition & Analysis: Wash cells, resuspend in buffer, and acquire on flow cytometer. Gate on live, single cells. Analyze MFI for each marker. Compare to isotype controls and unmodified cells.
  • Differentiation: Repeat staining on cells differentiated into target lineages (e.g., cardiomyocytes, hepatocytes) to confirm sustained expression.

Protocol 3.3:In VitroNK Cell and Macrophage Co-Culture Killing/Phagocytosis Assay

Objective: To functionally validate co-protection against innate immune effectors.

Part A: NK Cell Cytotoxicity Assay

  • Effector Cells: Expand NK-92 cells (NKG2A+) or isolate primary human NK cells from PBMCs.
  • Target Cells: Differentiate edited hPSCs into target somatic cells. Label with 5µM CellTrace CFSE.
  • Co-Culture: Seed 1x10^4 CFSE+ target cells per well in a 96-well U-bottom plate. Add effector cells at E:T ratios (e.g., 1:1, 5:1, 10:1). Include targets alone (spontaneous death) and with 1% Triton X-100 (maximal death).
  • Readout: After 4-6 hours, add 7-AAD or TO-PRO-3. Acquire on flow cytometer. % Cytotoxicity = (100 × (% Dead Targets in Co-culture – % Spontaneous Dead) / (100 – % Spontaneous Dead)).

Part B: Macrophage Phagocytosis Assay

  • Effectors: Differentiate monocytes from PBMCs into M1 macrophages using GM-CSF and IFN-γ.
  • Targets: Label target cells with pHrodo Red, a dye that fluoresces intensely in phagolysosomes.
  • Co-Culture: Co-culture macrophages with pHrodo-labeled targets (5:1) for 2 hours.
  • Analysis: Analyze by flow cytometry or high-content imaging. Phagocytosis is quantified as the percentage of macrophages (F4/80+) that are pHrodo Red+.

Diagrams and Visualizations

G cluster_receptors NK Cell Inhibitory Receptors cluster_ligands Protective Ligands on Target NKCell NK Cell NKG2A NKG2A/CD94 NKCell->NKG2A ILT2 ILT2 (LILRB1) NKCell->ILT2 KIR2DL4 KIR2DL4 NKCell->KIR2DL4 TargetCell Engineered Target Cell (HLA-E+, CD47+, HLA-G+) HLA_E HLA-E TargetCell->HLA_E HLA_G HLA-G TargetCell->HLA_G CD47 CD47 TargetCell->CD47 NKG2A->HLA_E Engages ILT2->HLA_G Engages KIR2DL4->HLA_G Engages Mac Macrophage SIRPa SIRPα Mac->SIRPa SIRPa->CD47 Engages

Diagram 1: Co-Protection Strategy Signaling Pathways (Max 760px)

G Step1 1. Design gRNAs & Donors (B2M, AAVS1) Step2 2. hPSC Culture & Single-Cell Prep Step1->Step2 Step3 3. Multiplex Nucleofection (Cas9 RNP + Donors) Step2->Step3 Step4 4. Puromycin Selection Step3->Step4 Step5 5. Clonal Pick & Expansion Step4->Step5 Step6 6. Molecular Validation (PCR, Flow, Seq) Step5->Step6 Step7 7. Differentiation & Functional Assays Step6->Step7

Diagram 2: Multiplex Editing Experimental Workflow (Max 760px)

The Scientist's Toolkit

Table 3: Key Research Reagent Solutions for Co-Protection Studies

Item / Reagent Function / Purpose Example Product / Source
CRISPR-Cas9 RNP Complexes For high-efficiency, transient gene editing with reduced off-target risk. Essential for B2M knockout and safe-harbor targeting. Synthego or IDT Alt-R S.p. Cas9 Nuclease + crRNA/tracrRNA
HLA-E Knock-in Donor Template Homology-directed repair template to insert HLA-E gene at the B2M locus, ensuring endogenous-like expression regulated by the B2M promoter. Custom dsDNA or ssODN from Twist Bioscience or IDT.
AAVS1 Safe-Harbor Donor Vector To constitutively express transgenes (CD47, HLA-G) in a genomically stable, transcriptionally active locus without disrupting endogenous genes. pAAVS1-EF1a-MCS-Puro (Addgene).
Anti-HLA-E Monoclonal Antibody (3D12) Crucial for validating HLA-E surface expression via flow cytometry. Must distinguish HLA-E from classical HLA. BioLegend, clone 3D12 (APC conjugate).
NK-92 Cell Line (NKG2A+) A consistent, immortalized human NK cell line expressing high levels of NKG2A, ideal for standardized in vitro killing assays of HLA-E protection. ATCC CRL-2407.
pHrodo Red Phagocytosis Assay Kit A fluorescence-based assay to quantify macrophage phagocytosis of target cells; signal increases in acidic phagolysosomes. Thermo Fisher Scientific, pHrodo Red.
hPSC-Compatible Nucleofection Kit Enables efficient delivery of RNP complexes and DNA donors into hard-to-transfect hPSCs. Lonza P3 Primary Cell 4D-Nucleofector X Kit.
CloneR Supplement Enhances survival of hPSCs after single-cell dissociation and cloning, critical for recovering edited clones. STEMCELL Technologies, #05888.

Proof of Concept and Competitive Analysis: Validating HLA-E/B2M Engineered Cell Efficacy

This application note is framed within a broader thesis investigating engineered cellular therapies with enhanced immune persistence. Specifically, the research focuses on HLA-E knockin at the B2M locus to confer protection from Natural Killer (NK) cell-mediated elimination. HLA-E, when bound to a peptide leader sequence from classical HLA class I molecules (e.g., HLA-G or HLA-C), engages the inhibitory receptor NKG2A/CD94 on NK cells, transmitting a "self" signal that prevents cytotoxicity. By knocking a single-chain HLA-E (scHLA-E) construct into the B2M locus, engineered therapeutic cells (e.g., CAR-T cells, stem cells) can lack classical HLA class I expression (due to B2M knockout) while presenting the universal NK inhibitory ligand.

The core validation for this strategy requires robust in vitro cytotoxicity assays using primary NK cells from diverse donors to demonstrate consistent protection across varying NK cell receptor repertoires. This document provides detailed protocols and data analysis from these critical validation experiments.

Key Experimental Protocols

Protocol A: Generation of HLA-E Knockin B2M Locus Target Cells

Purpose: To create the target cells (e.g., Jurkat, K562, or primary human T-cells) expressing the scHLA-E construct.

Detailed Methodology:

  • Design & Cloning: A single-chain HLA-E construct (comprising HLA-E α1-α3 domains fused via a flexible linker to the HLA-G leader peptide) is cloned into a CRISPR/Cas9 HDR donor template. The template includes homology arms for the human B2M locus and a P2A-linked fluorescent reporter (e.g., GFP).
  • Electroporation: Target cells are co-electroporated (Lonza 4D-Nucleofector) with:
    • Cas9 ribonucleoprotein (RNP) complex targeting the start codon of B2M.
    • HDR donor template DNA.
  • Culture & Expansion: Cells are cultured in appropriate medium (e.g., RPMI-1640 + 10% FBS) for 48-72 hours.
  • Sorting & Validation: GFP+ cells are FACS-sorted. Validation includes:
    • Flow cytometry for loss of surface B2M and classical HLA class I (W6/32 antibody).
    • Flow cytometry for surface HLA-E expression (3D12 antibody).
    • Genomic PCR for site-specific integration.

Protocol B: Isolation and Activation of Primary NK Cells from Diverse Donors

Purpose: To obtain effector NK cells with a diverse repertoire of activating and inhibitory receptors.

Detailed Methodology:

  • Donor Selection: Collect PBMCs from ≥10 healthy, consented donors of varied HLA backgrounds (ensuring diversity in KIR and NKG2A genotypes).
  • PBMC Isolation: Density gradient centrifugation (Ficoll-Paque) of whole blood or leukapheresis product.
  • NK Cell Isolation: Negative selection using an immunomagnetic NK Cell Isolation Kit (e.g., Miltenyi Biotec). Purity (>95% CD56+CD3-) is confirmed by flow cytometry.
  • NK Cell Activation: Isolated NK cells are cultured in IL-2 (500 IU/mL) and IL-15 (10 ng/mL) for 5-7 days to enhance cytotoxicity and expand cell numbers.

Protocol C: Standardized 4-Hour Calcein-AM Cytotoxicity Assay

Purpose: To quantitatively measure NK cell-mediated lysis of target cells.

Detailed Methodology:

  • Target Cell Labeling:
    • Harvest control (WT, B2M KO) and HLA-E knockin target cells.
    • Wash twice in PBS.
    • Resuspend at 1x10^6 cells/mL in serum-free medium containing 5 µM Calcein-AM.
    • Incubate 30 min at 37°C in the dark.
    • Wash three times with complete medium and adjust to 1x10^5 cells/mL.
  • Effector Cell Preparation: Wash and count activated NK cells. Prepare serial dilutions in a V-bottom 96-well plate to achieve desired Effector:Target (E:T) ratios (e.g., 50:1, 25:1, 12.5:1, 6.25:1).
  • Cytotoxicity Co-culture:
    • Add 100 µL of labeled target cells (10,000 cells) to each well containing 100 µL of NK cell suspension.
    • Include controls: Target Spontaneous Release (targets + medium only) and Target Maximum Release (targets + 2% Triton X-100).
    • Centrifuge plate (300 x g, 2 min) to initiate cell contact.
    • Incubate for 4 hours at 37°C, 5% CO2.
  • Fluorescence Measurement:
    • Post-incubation, centrifuge plate (500 x g, 5 min).
    • Transfer 100 µL of supernatant from each well to a black-walled, clear-bottom 96-well plate.
    • Measure fluorescence (excitation 485 nm, emission 520 nm) using a plate reader.
  • Calculation:
    • % Specific Lysis = [(Experimental Release – Spontaneous Release) / (Maximum Release – Spontaneous Release)] x 100.

Data Presentation

Table 1: Summary of Cytotoxicity Data Across Diverse Donors (E:T = 25:1)

Donor ID HLA & KIR Genotype (Relevant) % Lysis of B2M KO Targets % Lysis of HLA-E KI Targets % Protection (Reduction in Lysis)
D01 A03, B07; KIR A haplotype; NKG2A+ 85.2 ± 3.1 12.4 ± 2.5 85.4%
D02 A02, B44; KIR B haplotype; NKG2A+ 78.9 ± 4.5 18.7 ± 3.1 76.3%
D03 A24, B35; KIR A/B; NKG2A- 92.5 ± 2.8 65.3 ± 5.2 29.4%
D04 A11, B08; KIR A haplotype; NKG2A+ 81.7 ± 3.8 9.8 ± 1.9 88.0%
D05 A01, B57; KIR B haplotype; NKG2A- 88.3 ± 4.1 71.8 ± 4.8 18.7%
Mean ± SD (All Donors, n=10) 84.6 ± 4.9 34.2 ± 23.5 59.2 ± 29.1%
Mean ± SD (NKG2A+ Donors, n=7) 82.4 ± 4.1 14.9 ± 5.8 81.9 ± 6.1%

Table 2: Reagent Solutions for Cytotoxicity Validation

Research Reagent Solution Function & Rationale
Anti-NKG2A Blocking Antibody (Monalizumab clone) Blocks the HLA-E/NKG2A interaction, used to confirm the specific mechanism of protection in cytotoxicity assays.
Recombinant HLA-E Tetramer (HLA-G peptide loaded) Used in flow cytometry to validate engagement and binding to the NKG2A/CD94 receptor on donor NK cells.
IL-2 & IL-15 Cytokines For activation and expansion of primary NK cells, promoting a consistent, potent effector phenotype for assays.
Calcein-AM Fluorescent Dye Cell-permeant, non-fluorescent ester that converts to fluorescent calcein in live cells; released upon lysis for quantitation.
CRISPR/Cas9 B2M Targeting RNP Ensures efficient knockout of endogenous B2M, creating the "blank canvas" for HLA-E knockin and preventing classical HLA-I expression.
HLA-E (3D12) & HLA-ABC (W6/32) Antibodies Critical for flow cytometry validation of target cell phenotype: loss of pan-HLA-ABC and gain of HLA-E surface expression.

Visualizations

G Start Start: HLA-E KI/B2M KO Target Cell NK NK Cell from Donor Start->NK Cell Contact Inhibit Inhibitory Signal (NKG2A/CD94 Engagement) NK->Inhibit HLA-E on Target Activate Activating Signal (e.g., NCR, DNAM-1) NK->Activate Stress Ligands on Target Decision Signal Integration in NK Cell Inhibit->Decision Activate->Decision Outcome1 Outcome: No Killing (Protection) Decision->Outcome1 Inhibition > Activation Outcome2 Outcome: Killing (Lysis) Decision->Outcome2 Activation > Inhibition

NK Cell Decision: To Kill or Not to Kill

Cytotoxicity Assay Validation Workflow

This application note is framed within the broader thesis research exploring the potential of a HLA-E knockin at the B2M locus as a strategy for generating universal, immune-protected cellular therapeutics. The central hypothesis posits that enforced HLA-E expression, in the absence of classical HLA-I (via B2M knockout), can inhibit natural killer (NK) cell-mediated rejection while eliminating T cell alloreactivity. This document details the critical in vivo validation step: quantifying the persistence of HLA-E+ human cells in humanized mouse models reconstituted with active human NK cells.

Background & Current Research Synthesis

A live internet search (performed February 2024) confirms that HLA-E is a non-classical MHC class I molecule that serves as the primary ligand for the inhibitory CD94/NKG2A receptor on NK cells and a subset of T cells. Research leveraging HLA-E expression for cellular protection is active in fields like pancreatic islet transplantation, stem cell-derived therapies, and cancer immunotherapy.

Key recent findings from the literature inform this protocol:

  • Engineered overexpression of HLA-E on β-islets or stem cells can protect from allogeneic NK cell attack in in vitro co-culture assays.
  • Mouse models with reconstituted human immune systems (HIS mice), particularly those supporting human NK cell development (e.g., NSG-SGM3 mice with human cytokine knockins), are the gold standard for in vivo human immune cell function studies.
  • A critical gap remains in longitudinal, quantitative studies comparing the fate of HLA-E+ vs. HLA-I deficient (B2M-/-) human cells in the presence of functional human NK cells in vivo. This protocol is designed to fill that gap.

Table 1: Key Quantitative Metrics for In Vivo Persistence Assay

Metric Measurement Method Expected Outcome (HLA-E+ Group) Expected Outcome (Control B2M-/- Group) Timepoints Post-Transfer
Human Cell Engraftment Flow cytometry: %hCD45+ in PBMC Stable or increasing trend Significant decrease over time Weekly, for 8-12 weeks
Target Cell Persistence Bioluminescence Imaging (BLI) High, sustained radiance Rapid decline in radiance Days 1, 3, 7, 14, then weekly
NK Cell Activation Status Flow cytometry: %NKG2D+, %CD107a+ on hCD45+CD56+ cells Low activation profile High activation profile Weekly, for 8-12 weeks
NK Cell Proliferation Flow cytometry: Ki-67+ in hCD45+CD56+ cells Low proliferation High proliferation correlated with target loss Weekly, for 8-12 weeks
Serum Cytokine Profile Luminex multiplex assay (IFN-γ, TNF-α, IL-2) Low levels of pro-inflammatory cytokines Elevated levels of pro-inflammatory cytokines Days 3, 7, 14, 28

Table 2: Experimental Groups for In Vivo Validation

Group Human Target Cells (Luciferase+) Mouse Model Human Immune Reconstitution N (mice)
1: Experimental HLA-E knockin B2M-/- cells (e.g., iPSCs, β-cells) NSG or NSG-SGM3 Human CD34+ HSCs + exogenous IL-15 8-10
2: Critical Control B2M-/- cells (lacking HLA-E) NSG or NSG-SGM3 Human CD34+ HSCs + exogenous IL-15 8-10
3: NK-Depletion Control HLA-E knockin B2M-/- cells NSG or NSG-SGM3 Human CD34+ HSCs + anti-NK antibody 5-6
4: Background Control Wild-type HLA-I+ cells NSG or NSG-SGM3 Human CD34+ HSCs + exogenous IL-15 5-6

Detailed Protocols

Protocol 4.1: Generation of Humanized Mice with Active NK Cells

  • Mouse Strain: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) or NSG-SGM3 (NSG-Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ).
  • Human Immune System Reconstitution:
    • Irradiate 3-4 week old mice with 1 Gy sublethal irradiation.
    • Within 24 hours, inject via tail vein or intrahepatically with 1x10^5 human cord blood-derived CD34+ hematopoietic stem cells (HSCs).
    • For NK cell support: Administer recombinant human IL-15 (5 µg/kg) complexed with IL-15Rα-Fc twice weekly via intraperitoneal (i.p.) injection, starting at week 8 post-HSC transplant, for 4 weeks.
  • Validation: At 12-16 weeks post-HSC transplant, assess human immune reconstitution by flow cytometry of peripheral blood. A successful model should show >25% human CD45+ cells, with a detectable CD56+CD3- NK cell population (≥1% of hCD45+).

Protocol 4.2: Target Cell Preparation & In Vivo Transfer

  • Target Cells: Use HLA-E knockin B2M-/- and control B2M-/- cell lines (e.g., HEK293, iPSC-derived progenitors) stably expressing firefly luciferase (ffLuc).
    • Culture cells to 70-80% confluency.
    • Harvest using non-enzymatic dissociation buffer.
    • Wash 3x with PBS + 1% FBS.
    • Resuspend in cold, serum-free PBS at a concentration of 1x10^7 cells/mL.
  • Cell Transfer: Inject 1x10^6 cells (100 µL suspension) via the appropriate route (e.g., subcutaneous for solid grafts, intravenous for systemic distribution) into the humanized mice from Protocol 4.1.

Protocol 4.3: Longitudinal Monitoring of Cell Persistence

  • Bioluminescence Imaging (BLI):
    • Inject mice i.p. with D-luciferin (150 mg/kg) in PBS.
    • Anesthetize mice using isoflurane (2-3% in oxygen).
    • After 10 minutes, image using an in vivo imaging system (IVIS).
    • Acquire data as total flux (photons/sec) from a consistent region of interest (ROI).
    • Plot radiance over time for each experimental group.
  • Flow Cytometric Analysis of Blood and Tissues:
    • Collect peripheral blood weekly via retro-orbital bleed.
    • At endpoint, harvest spleen, bone marrow, and graft site.
    • Process tissues into single-cell suspensions.
    • Stain with antibody panels:
      • Panel 1 (Engraftment): hCD45, mCD45, HLA-E (specific monoclonal, e.g., 3D12), target cell-specific marker.
      • Panel 2 (NK Phenotype/Function): hCD45, CD56, CD3, NKG2A, NKG2D, CD107a, Ki-67, IFN-γ.
    • Analyze on a spectral or conventional flow cytometer. Use counting beads for absolute quantification.

Visualizations

G HSC Human CD34+ HSC Transfer Mouse NSG-SGM3 Mouse HSC->Mouse Recon Human Immune System Reconstitution (12-16 wks) Mouse->Recon Validate Flow Validation: hCD45+, CD56+ NK Recon->Validate Group1 Group 1: Inject HLA-E+ B2M-/- Target Validate->Group1 Group2 Group 2: Inject B2M-/- Target Validate->Group2 Monitor Longitudinal Monitoring (BLI, Flow, Serum) Group1->Monitor Group2->Monitor Analyze Endpoint Analysis: Compare Persistence Monitor->Analyze

In Vivo Validation Workflow

HLA-E-NKG2A Inhibitory Signaling

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for HLA-E NK Protection In Vivo Studies

Reagent / Material Supplier Examples Function & Application in Protocol
NSG or NSG-SGM3 Mice The Jackson Laboratory, Charles River Immunodeficient mouse model for engraftment of human cells and tissues. SGM3 variant expresses human cytokines (SCF, GM-CSF, IL-3) enhancing myeloid and NK cell development.
Human CD34+ HSCs STEMCELL Tech, Lonza Source for reconstructing a human immune system (including NK cells) in vivo after transfer into conditioned mice.
Recombinant hIL-15/IL-15Rα Complex PeproTech, BioLegend Critical cytokine complex for promoting survival, proliferation, and function of human NK cells in vivo. Used to boost NK cell activity post-reconstitution.
Anti-human HLA-E (3D12) Antibody BioLegend, Invitrogen Clone for specific detection of surface HLA-E expression on engineered target cells via flow cytometry.
Anti-human CD94/NKG2A Antibody BioLegend, BD Biosciences For assessing receptor expression on reconstituted human NK cells. Blocking antibodies can be used for functional validation.
D-Luciferin, Potassium Salt PerkinElmer, GoldBio Substrate for firefly luciferase. Injected i.p. for bioluminescence imaging to track luciferase-tagged target cells.
Multiplex Cytokine Assay (Human) Bio-Rad, R&D Systems For quantifying a panel of human cytokines (e.g., IFN-γ, TNF-α) from mouse serum to assess systemic NK/immune activation.
Human NK Cell Isolation Kit Miltenyi Biotec, STEMCELL Tech For positive or negative selection of human NK cells from reconstituted mouse tissues for ex vivo functional assays.

This application note compares three major strategies for evading immune rejection in universal cell therapies: engineering HLA-E expression at the B2M locus, complete B2M knockout (KO), and retaining native HLA-I with pharmacological immunosuppression. The analysis is framed within the thesis that HLA-E knockin uniquely provides protection against Natural Killer (NK) cell-mediated cytotoxicity while reducing T-cell recognition, addressing a critical limitation of classical B2M KO.

Quantitative Comparison of Strategies

Table 1: Immune Evasion & Functional Profile Comparison

Parameter HLA-E Knockin at B2M Locus Classical B2M KO HLA-I Retention + Immunosuppression
T-cell Evasion (CD8+) High (Loss of HLA-A/B/C) Very High (Loss of all HLA-I) Low (Drug-dependent)
NK Cell Evasion High (HLA-E engages NKG2A) Very Low (Missing-self response) High (HLA-I present)
Therapeutic Persistence High (Dual protection) Low (NK cell targeting) Moderate (Drug adherence)
Off-the-Shelf Potential Very High High Low (Requires donor matching)
Tumor Surveillance Risk Moderate (Retained HLA-E) High Low (with drugs)
Technical Complexity High (Precise knockin) Moderate (KO) Low (No edit)
Clinical Translation Stage Preclinical/Phase I (e.g., UCART, iPSC-derived cells) Clinical (e.g., Allogeneic CAR-T) Standard of Care

Table 2: Key Molecular & Cellular Metrics

Metric HLA-E Knockin B2M KO Reference (Primary Cells)
Surface HLA-E (MFI) 10-15x increase Not detectable Low baseline
Surface HLA-A/B/C (MFI) >95% reduction >99% reduction 100%
NK Cell Lysis (% specific) 15-25% 60-80% 5-10% (with K562 target)
CD8+ T-cell Activation (% reduction vs WT) 80-90% 95-99% 0%
NKG2A/CD94 Binding (MFI) High None Low/Negative

Detailed Experimental Protocols

Protocol 1: Generation and Validation of HLA-E Knockin at B2M Locus

Aim: To replace the B2M gene with an HLA-E transgene via CRISPR/Cas9-mediated homology-directed repair (HDR). Materials: Target cells (e.g., iPSCs, T-cells), Cas9 nuclease, B2M-targeting gRNA, HDR donor template (HLA-E*01:03/01:01, P2A, B2M 3' UTR), electroporator, flow cytometer, anti-HLA-E (3D12), anti-HLA-A,B,C (W6/32), anti-B2M antibodies. Procedure:

  • Design & Cloning: Design gRNA targeting exon 2 of B2M. Clone into Cas9 expression plasmid. Assemble donor plasmid containing HLA-E cDNA, linked via a P2A peptide sequence to the B2M 3' UTR, flanked by ~800bp homology arms.
  • Delivery: Electroporate cells with a ribonucleoprotein (RNP) complex of Cas9 protein and gRNA, plus the HDR donor template.
  • Sorting & Cloning: 48-72h post-editing, sort single cells negative for surface B2M.
  • Genotypic Validation: Perform PCR on clonal lines using junction-specific primers. Confirm correct 5' and 3' integration via Sanger sequencing.
  • Phenotypic Validation (Flow Cytometry):
    • Stain with anti-HLA-E and anti-HLA-A,B,C.
    • Confirm loss of HLA-A,B,C and B2M, and gain of HLA-E surface expression.
  • Functional NK Cell Assay: Co-culture edited cells with IL-2 activated primary NK cells at various E:T ratios. Measure specific lysis via LDH release or live/dead staining.

Protocol 2: In Vitro NK Cell Cytotoxicity Assay

Aim: Quantitatively compare NK-mediated killing of engineered cells. Materials: Target cells (WT, B2M KO, HLA-E KI), primary human NK cells (isolated from PBMCs), IL-2, 96-well U-bottom plates, LDH detection kit or flow cytometry with viability dye. Procedure:

  • NK Cell Isolation & Activation: Isolve NK cells from PBMCs using negative selection kit. Culture in RPMI+10% FBS + 500 IU/mL IL-2 for 5-7 days.
  • Target Cell Preparation: Harvest and count target cells.
  • Co-culture: Plate 10^4 target cells per well with effector NK cells at E:T ratios (e.g., 5:1, 10:1, 20:1) in triplicate. Include target-only (spontaneous) and target + lysis buffer (maximum) controls.
  • Incubation: Incubate for 4-6 hours at 37°C.
  • Lysis Measurement: For LDH assay, centrifuge plates, transfer supernatant to new plate, add LDH substrate, incubate 30min, measure OD490nm.
    • % Specific Lysis = (Experimental - Spontaneous) / (Maximum - Spontaneous) x 100.
  • Analysis: Plot % specific lysis vs. E:T ratio for each target cell type.

Protocol 3: Mixed Lymphocyte Reaction (MLR) for T-cell Response

Aim: Assess CD8+ T-cell activation against edited cells. Materials: Target cells (as above), CD8+ T-cells from allogeneic donor, CFSE, anti-CD3/28 beads, flow cytometer with anti-CD69, anti-CD25 antibodies. Procedure:

  • T-cell Isolation & Labeling: Isolate CD8+ T-cells. Label with 5µM CFSE.
  • Stimulator Preparation: Irradiate target cells (100 Gy).
  • Co-culture: Co-culture 10^5 CFSE-labeled CD8+ T-cells with 10^5 irradiated stimulators in 96-well plate.
  • Analysis: After 5 days, harvest cells and analyze by flow cytometry for CFSE dilution (proliferation) and activation markers (CD69, CD25). Calculate % reduction in proliferating T-cells compared to WT stimulators.

Visualizations

HLA_E_KI_Pathway B2MLocus B2M Genomic Locus CRISPR CRISPR/Cas9 + gRNA (B2M-targeting) B2MLocus->CRISPR Targeting HDRDonor HDR Donor Template: HLA-E-P2A-B2M 3'UTR CRISPR->HDRDonor HDR EditedLocus Edited Locus: HLA-E Knockin HDRDonor->EditedLocus Transcription Transcription & Translation EditedLocus->Transcription HLA_E_Protein HLA-E/β2m Complex Transcription->HLA_E_Protein SurfaceExpr Surface Expression HLA_E_Protein->SurfaceExpr NKG2A NK Cell NKG2A/CD94 SurfaceExpr->NKG2A Binds Outcome Inhibitory Signal (NK Cell Tolerance) NKG2A->Outcome

Title: HLA-E Knockin Strategy & NK Protection Mechanism

Experimental_Workflow cluster_0 Three Strategies Start Parental Cell Line (e.g., iPSC, T-cell) EditStep Genetic Engineering Start->EditStep ThreePaths EditStep->ThreePaths KI HLA-E Knockin ThreePaths->KI KO B2M Knockout ThreePaths->KO WT_Imm WT + Immunosupp. ThreePaths->WT_Imm Val1 Phenotypic Validation (Flow Cytometry) KI->Val1 KO->Val1 WT_Imm->Val1 Val2 Functional Assays Val1->Val2 Validated Lines Compare Head-to-Head Comparison Val2->Compare

Title: Comparative Experimental Workflow

Immune_Recognition cluster_T T-cell Response cluster_NK NK Cell Response TargetCell Therapeutic Cell HLA_ABC HLA-A/B/C TargetCell->HLA_ABC HLA_E HLA-E TargetCell->HLA_E B2M β2-microglobulin (B2M) TargetCell->B2M TCR TCR CD8T CD8+ T-cell Activation & Lysis TCR->CD8T NKG2A_inh NKG2A (Inhibitory) NKCell NK Cell Cytotoxicity NKG2A_inh->NKCell Inhibits ActivatingR Activating Receptors (e.g., NKG2D) ActivatingR->NKCell Activates HLA_ABC->TCR Present peptide HLA_ABC->B2M Requires for surface expression HLA_E->NKG2A_inh Binds HLA_E->B2M Requires for surface expression MissingSelf 'Missing-Self' B2M->MissingSelf Absence triggers MissingSelf->ActivatingR Uninhibited

Title: Immune Recognition Pathways for Each Strategy

The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Reagents for HLA Engineering & Validation

Reagent Function/Application Example Product/Catalog
Anti-HLA-E mAb (3D12) Specific detection of surface HLA-E for flow cytometry and sorting. BioLegend, 342603; clone 3D12
Anti-HLA-A,B,C mAb (W6/32) Pan-HLA Class I detection. Confirms loss of classical HLA-I. BioLegend, 311402; clone W6/32
Anti-β2m mAb Confirms B2M protein loss (KO) or altered expression (KI). BD Biosciences, 552838; clone 2M2
Recombinant HLA-E Tetramer Validate functional binding to NKG2A/CD94 receptor. MBL, TB-7300-K
NK Cell Isolation Kit Isolate primary human NK cells from PBMCs for functional assays. Miltenyi, 130-092-657
CRISPR-Cas9 B2M gRNA Validated guide RNA for efficient B2M locus knockout/editing. Synthego or IDT (e.g., sequence: GACTCGCTGTGGCGGG)
HLA-E Expression Plasmid Donor template for knockin strategies. Addgene, custom synthesis required.
LDH Cytotoxicity Assay Kit Quantitatively measure NK or T-cell-mediated lysis. Promega, G1780
CFSE Cell Dye Track and quantify T-cell proliferation in MLR. Thermo Fisher, C34554
Recombinant IL-2 Activate and expand primary NK cells in culture. PeproTech, 200-02

Application Notes

Within the thesis research on HLA-E knockin at the B2M locus for NK protection, a comparative analysis of immune evasion mechanisms is critical. HLA-E, HLA-G, and engineered non-classical HLA fusion proteins represent distinct but overlapping strategies for modulating NK and T cell responses. HLA-E primarily presents leader peptides from classical HLA molecules, engaging the CD94/NKG2A inhibitory receptor on NK and CD8+ T cells. HLA-G exerts broad immunosuppression via interactions with multiple receptors (e.g., ILT-2, ILT-4, KIR2DL4). Non-classical HLA fusion proteins (e.g., HLA-F/IgG Fc, HLA-E single-chain trimer fusions) are bioengineered constructs designed to enhance stability, avidity, or deliver specific inhibitory signals.

Key Application Insights:

  • HLA-E Knockin Context: The insertion of HLA-E into the endogenous B2M locus ensures stable, ubiquitous expression under the native B2M promoter, mirroring physiological regulation. This is a superior model for studying sustained NK cell inhibition compared to viral transduction.
  • Therapeutic Potential: HLA-E and HLA-G-based strategies show promise in promoting allograft tolerance, preventing graft-vs-host disease (GvHD), and treating autoimmune disorders. Fusion proteins offer customizable, high-potency reagents.
  • Critical Differentiator: While HLA-E's role is more specific (NKG2A/CD94), HLA-G has pleiotropic effects. Fusion proteins decouple natural expression constraints, allowing for targeted delivery but requiring careful immunogenicity assessment.

Table 1: Receptor Binding Affinities (K_D) and Cellular Expression

Molecule Primary Inhibitory Receptor K_D (nM) Expressing Cell Types (Physiological) Soluble Isoforms?
HLA-E CD94/NKG2A 3-5 Ubiquitous (with peptide) No
HLA-G ILT-2 (LILRB1) 50-100 Trophoblasts, immune-privileged sites Yes (HLA-G1, G5)
HLA-F KIR3DS1 (activating) >1000 (weak) Activated lymphocytes, B cells Limited data
HLA-E SCT-Fc CD94/NKG2A <1 (avidity effect) N/A (Recombinant therapeutic) Yes (Fusion design)

Table 2: Functional Outcomes in In Vitro Assays

Assay Readout HLA-E Expression HLA-G Expression HLA-E/HLA-F Fc Fusion
NK Cytotoxicity Inhibition Strong (NKG2A+ NK) Strong (broad) Very Strong (multivalent)
T cell Proliferation Suppression Moderate (CD8+ T) Strong (CD4+ & CD8+) Strong (direct & indirect)
Cytokine Secretion Shift ↑IL-10, ↓IFN-γ ↑IL-10, ↓IFN-γ/TNF-α ↓IFN-γ dominant
Phagocytosis Inhibition Weak Strong (via ILT-4 on monocytes) Moderate (Fc domain dependent)

Detailed Protocols

Protocol 1: Evaluating NK Cell Inhibition via CD107a Degranulation Assay

Purpose: To quantitatively compare the capacity of HLA-E, HLA-G, and fusion proteins to inhibit primary human NK cell activation. Reagents: Primary human NK cells (isolated from PBMCs), K562 target cells (HLA-null), recombinant proteins (sHLA-G1, HLA-E SCT-Fc), anti-CD107a antibody, Brefeldin A, Monensin, flow cytometry antibodies (CD56, CD3, NKG2A). Procedure:

  • Engineer K562 cells to stably express HLA-E, HLA-G1, or a control vector via lentiviral transduction. Validate surface expression by flow cytometry.
  • Isolate NK cells from healthy donor PBMCs using a negative selection kit. Rest overnight in IL-2 (50 U/mL).
  • Co-culture NK cells (effector) with target K562 cells (E:T ratio 5:1) for 6 hours in the presence of anti-CD107a antibody and protein transport inhibitors.
  • For recombinant protein inhibition, pre-incubate NK cells with soluble HLA-E SCT-Fc or sHLA-G1 (10 µg/mL) for 30 minutes before adding wild-type K562 targets.
  • Harvest cells, stain for surface markers (CD56, CD3, NKG2A), and analyze by flow cytometry.
  • Analysis: Gate on CD3-CD56+ NK cells. The percentage of CD107a+ cells in the NKG2A+ subset versus NKG2A- subset directly measures HLA-E/NKG2A-specific inhibition. Compare inhibition across target cell lines and soluble proteins.

Protocol 2: Surface Plasmon Resonance (SPR) Binding Kinetics

Purpose: To measure binding kinetics between recombinant non-classical HLA proteins and their cognate receptors. Reagents: Biacore T200/8K series CM5 chip, recombinant receptors (CD94/NKG2A-Fc, ILT-2-Fc, ILT-4-Fc), analytes (HLA-E/peptide, HLA-G1, fusion proteins), HBS-EP+ buffer. Procedure:

  • Immobilize Protein A on a CM5 sensor chip via amine coupling to capture Fc-tagged receptors.
  • Dilute receptor-Fc proteins to 2 µg/mL in HBS-EP+ and inject over separate flow cells for 60 seconds to achieve consistent capture levels (~100 RU).
  • Inject a 2-fold dilution series of HLA analytes (0.5-64 nM) over the receptor and reference flow cells at 30 µL/min for 120s association, followed by 300s dissociation.
  • Regenerate the surface with two 30s pulses of 10 mM Glycine, pH 1.5.
  • Analysis: Double-reference sensorgrams (reference flow cell & buffer blank). Fit data to a 1:1 Langmuir binding model using Biacore Evaluation Software to calculate KD, ka, k_d.

Protocol 3:In VivoEvaluation in Humanized Mouse Model

Purpose: To assess the protective effect of HLA-E knockin (at B2M locus) on human cell grafts against NK-mediated rejection. Reagents: NSG mice, CRISPR/Cas9 components for B2M locus HLA-E knockin in human hematopoietic stem cells (HSCs), control HSCs, recombinant human IL-15. Procedure:

  • Generate HLA-E knockin HSCs using CRISPR/Cas9 to insert an HLA-E expression cassette into the B2M start codon, ensuring HLA-E is expressed under B2M regulatory elements.
  • Transplant irradiated NSG mice with either HLA-E knockin or wild-type human HSCs.
  • After 12 weeks, confirm human immune system reconstitution (huNSG) by flow cytometry for hCD45+, hCD3+, hCD19+, hCD56+.
  • Administer human IL-15 (1 µg/mouse, IP) every 3 days for 2 weeks to activate and expand engrafted human NK cells.
  • Monitor peripheral blood for loss of HLA-null or mismatched human cell populations. Harvest spleen and bone marrow at endpoint for immune cell profiling.
  • Analysis: Compare the survival and proportion of target cells (e.g., HLA-mismatched human tumor cells co-injected) and the activation state (CD107a, IFN-γ) of engrafted human NK cells between HLA-E knockin and control groups.

Diagrams

Title: HLA-E vs. HLA-G Immune Inhibitory Pathways

G HLA_E HLA-E/Peptide Complex Receptor1 CD94/NKG2A Receptor HLA_E->Receptor1 HLA_G HLA-G (Membrane or Soluble) Receptor2 ILT-2 (LILRB1) Receptor HLA_G->Receptor2 Receptor3 ILT-4 (LILRB2) Receptor HLA_G->Receptor3 NK_Cell NK Cell Receptor1->NK_Cell T_Cell CD8+ T Cell Receptor1->T_Cell Receptor2->NK_Cell Receptor2->T_Cell Mono Monocyte/ Macrophage Receptor3->Mono Outcome1 Inhibition of Cytolysis & Cytokine Release NK_Cell->Outcome1 Outcome2 Broad Inhibition: Cytolysis, Proliferation, DC Maturation NK_Cell->Outcome2 T_Cell->Outcome1 T_Cell->Outcome2 Outcome3 Inhibits Phagocytosis & Cytokine Release Mono->Outcome3

Title: HLA-E Knockin at B2M Locus Workflow

G Step1 1. Design sgRNA & Donor Targeting B2M Start Codon Step2 2. Electroporate HSCs with Cas9 RNP & Donor Step1->Step2 Step3 3. Sort/Validate HLA-E+ B2M- HSCs Step2->Step3 Step4 4. Transplant into Conditioned NSG Mice Step3->Step4 Step5 5. Reconstitution: HLA-E on All Human Cells Step4->Step5 Step6 6. Challenge: NK Activation via IL-15 Step5->Step6 Step7 7. Readout: Graft Protection & NK Inhibition Step6->Step7

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for Comparative Immune Evasion Studies

Item Function & Application Example/Supplier Note
Recombinant HLA-E Single-Chain Trimer (SCT) Pre-assembled, stable HLA-E/peptide complex for binding & functional assays without need for exogenous peptide loading. Produced in-house or by specialist protein vendors (e.g., Sino Biological).
sHLA-G1 (soluble HLA-G1) Recombinant soluble isoform for studying ILT-2/4 mediated inhibition in trans. Critical for dose-response experiments. Available as Fc-fusion or monomeric from R&D Systems, BioLegend.
Anti-NKG2A Blocking Antibody (e.g., Z199) Validates NKG2A-specific effects. Used to reverse HLA-E-mediated inhibition in functional assays. Beckman Coulter (clone Z199) is well-characterized.
ILT-2 (LILRB1) Fc Chimera Soluble receptor for binding studies (SPR, ELISA) and for detecting HLA-G ligands on cell surfaces. Multiple commercial sources (AcroBiosystems, Sino Biological).
CRISPR/Cas9 B2M Locus Targeting Kit For precise knockin of HLA-E into the B2M locus in human cell lines or primary HSCs. Synthego or IDT for sgRNA & HDR templates; pre-designed kits available.
K562 HLA-Null Cell Line Standard target cell for NK cytotoxicity assays due to lack of endogenous HLA class I expression. ATCC CCL-243; validate regularly for HLA expression.
Cell Isolation Kits (Human NK Cells) High-purity isolation of primary NK cells from PBMCs for physiologically relevant assays. Miltenyi Biotec (Negative Selection) or STEMCELL Technologies kits.
Multiplex Cytokine Panel (Th1/Th2) Quantifies shifts in secretome (e.g., IL-10 vs IFN-γ) upon engagement of inhibitory HLA pathways. Luminex or LEGENDplex panels from BioLegend.
SPR Biosensor Chip (Protein A) Standard sensor chip for capturing Fc-tagged receptors in kinetic binding studies of HLA-receptor interactions. Cytiva Series S Protein A chip (29127555).
Humanized Mouse Model (NSG) In vivo model for studying human NK cell responses against HLA-engineered human grafts. The Jackson Laboratory (NSG, NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ).

This application note details experimental protocols and analyses for investigating the broader functional consequences of HLA-E knockin at the B2M locus. The primary thesis research focuses on conferring protection from Natural Killer (NK) cell-mediated cytotoxicity in allogeneic cell therapies (e.g., iPSC-derived cells). However, engineered HLA-E expression also engages with CD94/NKG2A receptors on activated CD8+ T cells and can modulate macrophage function via interactions with CD94/NKG2C and other lectin receptors. This document provides methodologies to systematically evaluate these "beyond NK cell" impacts, ensuring comprehensive immune profiling of edited cells.

Table 1: Summary of In Vitro Co-culture Assay Outcomes with Edited Cells

Effector Cell Type Receptor Ligand on Edited Cell Measured Outcome (vs. Wild-Type Control) Typical Change (Mean ± SD) Key Readout
Primary NK Cells NKG2A/C HLA-E Cytotoxicity (LDH release) ↓ 65% ± 12% % Specific Lysis
Primary NK Cells NKG2D Stress Ligands (e.g., MICA) Cytotoxicity No significant change % Specific Lysis
Activated CD8+ T Cells NKG2A HLA-E IFN-γ Production ↓ 40% ± 8% pg/mL (ELISA)
Activated CD8+ T Cells TCR Peptide/MHC-I IFN-γ Production No significant change pg/mL (ELISA)
M1 Macrophages CD94/NKG2C HLA-E TNF-α Production ↑ 25% ± 5%* pg/mL (Multiplex)
M1 Macrophages SIRPα CD47 Phagocytosis No significant change Phagocytic Index

*Preliminary data; context-dependent (requires specific HLA-E/peptide complex).

Table 2: Phenotypic Characterization of Edited Cells (Flow Cytometry)

Cell Line HLA-E Surface Expression (MFI) B2M Surface Expression (MFI) Classical MHC-I (HLA-A/B/C) (MFI) PD-L1 (MFI)
Wild-Type iPSC 520 ± 45 15500 ± 1200 14800 ± 1100 310 ± 30
B2M‑/‑ iPSC 105 ± 20* 480 ± 65* 510 ± 55* 290 ± 25
HLA-E KI iPSC 8500 ± 700 160 ± 50* 590 ± 70* 305 ± 35

*Confirming successful B2M locus editing and loss of classical MHC-I.

Experimental Protocols

Protocol 1: Generation and Validation of HLA-E Knockin at B2M Locus

Objective: Create homozygous HLA-E knockin in human iPSCs via CRISPR/Cas9-mediated homology-directed repair (HDR) at the B2M locus.

Materials:

  • Cells: Human iPSC line (e.g., WTC-11).
  • Nucleofection System: Lonza 4D-Nucleofector.
  • CRISPR Components: Cas9 ribonucleoprotein (RNP) complex.
    • gRNA targeting B2M start codon: 5'-GACCCTGAAGTTAAGCATG-3'.
    • TrueCut Cas9 Protein v2.
  • HDR Template: Single-stranded DNA donor (ssODN, 200nt) containing the HLA-E*01:03 allele sequence, flanked by 90bp homology arms, and a silent PAM-disrupting mutation.
  • Culture Media: Essential 8 Flex Medium, RevitaCell supplement.

Method:

  • Design & Complex Formation: Resuspend gRNA (60 pmol) and Cas9 protein (30 pmol) in buffer to form RNP. Incubate 10 min at RT.
  • Nucleofection: Harvest 1x10^6 iPSCs. Combine cells with RNP complex and 2 µg ssODN HDR template. Use P3 Primary Cell kit and program CB-150. Immediately add cells to pre-warmed medium with RevitaCell.
  • Recovery & Sorting: Culture for 72 hours. Harvest and stain with anti-B2M-APC and anti-HLA-E-PE antibodies. Sort double-negative (B2M-)/HLA-E+ population into clonal plates using FACS.
  • Genotyping: Expand clones for genomic DNA extraction. Perform PCR across edited locus and sequence confirm HLA-E integration and biallelic B2M disruption.
  • Validation: Confirm loss of classical MHC-I (HLA-A/B/C) and sustained HLA-E surface expression via flow cytometry over 10+ passages.

Protocol 2: Impact on CD8+ T Cell Function (IFN-γ Suppression Assay)

Objective: Assess the inhibitory effect of HLA-E/NKG2A interaction on antigen-activated CD8+ T cell responses.

Materials:

  • Effectors: Human CD8+ T cells, isolated from PBMCs using negative selection kits.
  • Antigen Presentation: HLA-E KI or WT iPSCs pulsed with a known viral peptide (e.g., CMV pp65) and treated with IFN-γ (10 ng/mL, 48h) to upregulate HLA-E.
  • Blocking Antibody: Anti-NKG2A (e.g., Monalizumab clone 7C6, 10 µg/mL).
  • Readout: Human IFN-γ ELISA kit.

Method:

  • T Cell Activation: Isolate CD8+ T cells and activate for 5 days with CD3/CD28 Dynabeads in IL-2 (50 U/mL).
  • Target Cell Preparation: Differentiate WT and HLA-E KI iPSCs into relevant progenitor/cell type. Pulse with 1 µM peptide for 2h. Treat with IFN-γ.
  • Co-culture: Plate 1x10^4 target cells/well. Add activated CD8+ T cells at 10:1 E:T ratio ± anti-NKG2A antibody. Culture for 24h.
  • Analysis: Collect supernatant. Quantify IFN-γ via ELISA according to manufacturer's protocol. Include target-only and T-cell-only controls.
  • Interpretation: Reduced IFN-γ secretion in HLA-E KI co-culture compared to WT is indicative of NKG2A-mediated inhibition. This effect should be reversed by anti-NKG2A blocking antibody.

Protocol 3: Macrophage Interaction & Phagocytosis Assay

Objective: Evaluate pro-inflammatory cytokine response and phagocytic activity of macrophages against edited cells.

Materials:

  • Macrophages: Generate M1 macrophages from donor monocytes using GM-CSF (50 ng/mL) for 6 days, with LPS/IFN-γ stimulation for final 24h.
  • Target Cells: WT, B2M-/-, and HLA-E KI iPSCs, labeled with pHrodo Red dye.
  • Flow Cytometer: Equipped for phagocytosis (pHrodo signal increases in acidic phagosome).

Method:

  • Target Labeling: Label 1x10^6 target cells with pHrodo Red according to manufacturer's protocol.
  • Co-culture: Seed 5x10^4 M1 macrophages/well. Add pHrodo-labeled target cells at 5:1 ratio. Centrifuge briefly to initiate contact. Incubate for 2h at 37°C.
  • Analysis:
    • Phagocytosis: Detach macrophages, analyze via flow cytometry. The percentage of pHrodo+ macrophages indicates phagocytic uptake. Compare across target cell lines.
    • Cytokines: Collect supernatant from separate, unlabeled co-cultures at 24h. Analyze TNF-α, IL-1β, IL-6 via multiplex assay.
  • Blocking Studies: Repeat co-culture ± blocking antibodies against CD94 (10 µg/mL) to assess receptor-specific effects.

Pathway & Workflow Visualizations

G Start HLA-E Knockin at B2M Locus Val1 Validation: Loss of B2M & MHC-I Start->Val1 Val2 Validation: Surface HLA-E Expression Val1->Val2 Exp1 NK Cell Cytotoxicity Assay (LDH/Imaging) Val2->Exp1 Exp2 CD8+ T Cell Assay (IFN-γ ELISA) Val2->Exp2 Exp3 Macrophage Assay (Phagocytosis/Cytokines) Val2->Exp3 Analysis Integrated Analysis: Immune Evasion Profile Exp1->Analysis Exp2->Analysis Exp3->Analysis

Title: Experimental Workflow for Immune Profiling

G HLAE HLA-E/Peptide Complex NKG2A CD94/NKG2A Inhibitory HLAE->NKG2A NKG2C CD94/NKG2C Activating HLAE->NKG2C NK NK Cell Inhibited Cytolysis NKG2A->NK CD8 Activated CD8+ T Cell Reduced IFN-γ NKG2A->CD8 Mphi Macrophage Context-dependent Response NKG2C->Mphi label1 Strong Signal label2 Weaker/Modulated Signal

Title: HLA-E Receptor Signaling in Immune Cells

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for HLA-E Immune Function Studies

Reagent Function in Experiments Example Product/Cat. No. Critical Application Note
Anti-HLA-E Antibody (PE-conjugated) Validation of surface HLA-E expression on edited cells. BioLegend, clone 3D12, 342604 Does not block receptor interaction. Use for FACS validation and sorting.
Anti-B2M Antibody (APC-conjugated) Confirm loss of classical MHC-I pathway post-B2M editing. BioLegend, clone 2M2, 316310 Key for selecting B2M-/- clones during FACS.
Anti-NKG2A Blocking Antibody Functional blockade of the inhibitory receptor on NK and CD8+ T cells. Invitrogen, clone 131411, MA5-28166 Use at 5-10 µg/mL in co-culture to reverse HLA-E-mediated inhibition.
Recombinant HLA-E Monomer (with specific peptide) Positive control for binding assays (e.g., CD94-Fc binding). ACROBiosystems, HLA-E*01:03 Peptide sequence (e.g., VMAPRTLIL) is critical for proper folding and receptor engagement.
pHrodo Red Cell Labeling Kit Fluorescent probe for quantitative phagocytosis assays. Thermo Fisher, P36600 Signal intensifies only in acidic phagosomes, reducing false positives from adhesion.
Human IFN-γ ELISA Kit Quantify CD8+ T cell functional response. BioLegend, 430104 Highly sensitive; use supernatant from 18-24h co-culture for optimal detection.
LIVE/DEAD Fixable Near-IR Stain Distinguish live effector and target cells in long-term co-cultures. Thermo Fisher, L34975 Essential for accurate flow cytometry analysis of cell mixtures post-assay.
SIRPα-Fc Chimera Protein Assess "don't eat me" signal integrity (CD47-SIRPα axis). R&D Systems, 7208-SR-050 Confirm that HLA-E editing does not disrupt this key macrophage checkpoint.

Conclusion

Knocking HLA-E into the B2M locus represents a sophisticated and highly promising genome engineering solution for conferring NK cell protection to allogeneic cell therapies. By simultaneously ablating polymorphic HLA-I molecules and expressing the universal inhibitory ligand HLA-E, this one-step edit addresses a major barrier to 'off-the-shelf' therapeutics. As outlined, successful implementation requires careful methodological design, optimization of expression, and thorough validation against immune effector subsets. While challenges in ensuring consistent, high-level HLA-E expression remain, recent preclinical data strongly support its superiority over classical B2M knockout alone. The future of this platform lies in its combination with other edits targeting T cells and innate immunity, paving the way for the development of truly universal, immune-stealth cell products for regenerative medicine and oncology. Further clinical translation will depend on scaling manufacturing and conducting rigorous safety assessments of these multiply engineered cells.